Description :
From Genome Similarity Track
Location :
Scaffold_29:24216- 28340
Sequence
4124 bases(100 bases per row)
AAGGGAAGGTAACCGGTAGTGATTGCATTTTCCTCCTTTATTGGGGGTGGTGCGCGTTTGTGTGAGTCTCAGGGGAGCTAGGCCCCTGAATTTCAGACTC
GAGTGAGCCTAGTGTGATTGTGACCCACCGTCCAAGGGTCCAAAAGAATAAGTGACGGCTAGTTGTAGTGTTTGTATACTCTGTATTTGTTGGTTTTATC
GCGCTAGGAGGGCATTTGGGTAAGGTATCTTCTGAGTTCCAAGTCCCGGAGTTGACTGAAATCCTGGACCCTGAATACGTGATATTCTGGGTTTTGGGGG
ATCTGATTCTCTGGGTTTGTCTTTGGTGTGGAGGTGCGTTCTGAATTAGACGTGCACTTCCGCACTTCTTCGAGGCTACATTTACGACCGGTGGAGTGCC
GTTCCATCGAAGACAAAAGAGCCGACAGGGATTACACAAGGTACCCACGCCAACCAAGGAGTGTGATTTCCAGGATTTAAAGCTTTGCGGCTGCGAATCT
CTGGGTCTACCTTCTCGCCGTTGACTCTCAAGTCGATTCTCTGGGTCTACACACTGAGATTCCGTCTTGGGCTGCGCTATACGAACCCCCCTGGGCGATA
AAGGTTTCATCGGCCTCGCCTCACCTATCGCAATTATCCAGTCGGAGCGAAAGGCAAAGTTGCGGGTTCAGCAATTCCACAAGCTCTGATAAACGGCGCG
GACACTTAAAGGAATCTGCTTTGATAATATTAGAACCCGTTCCACCAGGCCAAACTAACTAAGCGTAGAAAAATTCAGAAGCAAAATCCGCGCTGTATCG
GGAACAGCACGCAAACAAACTTATAGCGAGCGTGTTGATCTTAACAACCCAGTGTGAGACCTCCCCCGGCACCAAGACCACCGACATCGTTCACTGATCT
ACTACATTCCAGCACAAATTCAGAATTCCCGGTCCTCCCGGCTATGCGGAACCTGCATGTACAAGAGAGCGCATCGGTCCAGCTGCACCCAGTCTTATTG
CATTCACAAACATGGGGACATCCTGGTCGCAGACTATTTTGGATAGGGTTGCCAACAACTCGACCAAACATGTAAAGGGTAATCACCTTGTTAAAGCATT
TTGTTCTAATAAAACCCTTTGTAAGTACTACACTGGAATAACGAACGAGGCGACTGAGCCTCATCCCATGTGTGCTCGCGAAATCGCCGTTGGGTCTTGC
GCGAAGCTCGAGCTGGCTCAGGTTCAGCGATGCGACGATGCAGGCGCTGAGCAAGAGACATACTCACCAAGATCCCATGGATGACCCTCCAACATAATAG
CAACATTCTCCACCGAGTCAATCGTTTGCTTCTTTGCCTTGGAGAGCTGCCGTAATAATCGACGGCATTTTTGGCGGTATGTTCGAGAGTGTTTCCGGCG
GGTGATCCGCTTGGAACGCAAGCATCCAGCACGAACGCCCTGCTTGAGCATATCCCACGCGCGTGCTGTGTCGGTAGAGCTGTGATCTCCATCCGCGAGC
CAATCACAGATCTATGGTGCCGTGAACGGAGGCATCAACCGTATGCCGGCACCGGGTAAATACGGTCATTTTTATCTAGTCGCACAGGATTGGACGGTGG
ACGTAGGTGCAGCAACACTCTATCATGATCACTCAGCGACCCATTGTAACGGTGGGTACCACCGTAACGCAGGCGCAGAGCCGTACAGCGATCGATTTTG
CTTGTGGCAACTCCACCCTCCACAATGTATATGTAGGTGTGATACGCGTGATGGAGGGCGTTGGTCCGTGCGGGATCAGTGTGCGCCGGCATTGCCAATC
GCAGGCAGTCGGATAGGCCCCAGTGCTTGAGGAGCTTTCTGAGAGCCGGAGAGTCATGTGTGCTTGGTAGATGGCGGTACGCGCGGTCCAAAACTGGTTC
AAGAGTGCAGTTAAAGTCTCCTCTAAGAACGCCGATATAGCCATCGCGCACGAAAGCTGCAGCACCTCCCAAAGAACTGTTCACGTTCGTCTCGGTCAGT
CGGTGCGTAGATGTTTACCAAAGGGGCACGTTGACTGCCGAAGGTACCCGTGATGGCGACGAGTCGGGACGACCATTTATCTCTCCACAGCGCATTTGGA
TCTGAGAAGGCGCCGTGGGGGATAGATAAGGATAGCTGTACCCCCTTGACTGTCTTGTGCCAGTCTCCGAAGTGATAACGACAGATACTGCGATCCCACA
CGAAATCCCCATCGTTGCGCATGTTCCCGGAACGTCTGGTCAATTACATTCACGCCCACATGCGTCTCCTAACATCCGGTCGGCCGTGCTCACTGTGTTC
AGCCAGCTTACTTACCCAAACAGCATGTTTTGCCGCTGTTACACCGAAGCCACGTACAGTTTGTGTCCGAAACCCAACAAGGGTTACACGCACAAGTGGC
TATAGTCACCATCTCCACGTAGTCGTCCTCGAAGTCAACGGCATCGTTGACTACAGAAGAACCTTCGAGGACAATCTCTGGCTGAGTTGTCCCCGCCGCA
GCCTTGGCAGCAAGAGCGTCACGCTTTGCTTTGTGACGCTCGCGATACTGGGGGATAGAGAGAGTCTCTATCCCGGCAGAGGACTTCTCCTCTGCTGCAG
CGTCGGTCTTCTTCTGAGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTG
CCGTGACTCGGCGCGTCAAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCCACAGGCACTTGTAACTCTAACAGACACGACGTCTGT
TAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTTGACACACCAAAGGCTACATACATTTACGACCGCCACGACGGGTGGTCCATAGAGACTTAGGATTCC
TATTGGCTGAGAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCGTTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCCAGTTTAGAATATTACAT
TTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAATCATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCC
CGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGTACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACAAGG
CCCCTGAGGGCCCTTAATTGCGGAAGGGCCTGGAGACGATAGCGGCAGCAGGTGTGTCACTCTTGTCTATCCACGTTTGCCCCGCTGATACTTGAAGCAC
TGCGCTCCAATCTTCGAGCTCGAGAATGCCGTGACATAGTACCCGAACACTAGGAAACTCGTGATACCCCACACTACGAGCACCTGTGGGTGCCCTGCCC
ATCGGAGAAGTGGACCATGTACTGACGACGTAAGGTAGTACAGGAAGAAGAGCCCATCCGTCTGCTTCGAGGCCTGTTCCGTTCTCGCGACATCGCTCCA
TTCCAACTGCCGTGCGTCTTAATCGTGCCCAGCGCGGACCGTCATCCGTCAAAGCGTGCCTAGTCCTTTGTTGGTAGCGTTGTGCCACGCAACACAAAAG
TCTATCGCCTCTTGACTGATGGAGTTGTCATGCATAAGGCGCCATATAGCGTCTGTCTGCTCTCGGTATACTTCCACCTCGCCCCTCTTAACTAGCTGTT
CAAACTCCCACTGTTTTGTCTCTAACTCCGGATACGGTAGGAAGGCGAAAAGATGGCGAAGAGCAGTGATGTTGCTCAACAACCACTTCGAGGGTTACTG
CGTCTGAGAGTGGGAGGAATCTGCAGCCGGGTCTGGTACAACGAGCACCACGCCGCGAATGCTTCCATGTTAGCGGCCGCGAAAAGCTTGTGCTGAGCGT
AGTCATCGGGATCAATCTCTTCGCCCGCCTGGGCTCGAAGTAGGTGAAAGTAAGCGTGCTCAACCACTTCGCCAGTAGATACACGGTGGTGGCGCCTCGG
CAACGCGATGTCCATGTCCGTCCCGTCTTGGCTGGCGTGAGAACCACTCGCATATCCGTCAATACCAATTGCCTCTTGCAGCAGTTTGCCTTCGGAGGCT
ACGGTCTCGTCAAGACCAGCTTCA