Description :
From Genome Similarity Track
Location :
Scaffold_4:242153- 245332
Sequence
3179 bases(100 bases per row)
CTGGAAGCACTTCCTCCATGATCTTAAGGGAGGCATAATCGAACAGGTATGCTTGATCACCAACGAGTTCGTTACCGAGACAAGCGAAGAGCATATGACG
CGTCCTCGTCGCGCTGAACCGAAGTCAGCGCGTGAAGGACGATTTGAGTCGCAGTCATGGAACACTCTCCGAGAGTCTGGGAATCCTGTCTACAATATTG
CTCGTGAGTATGCAGACGTGTTCCCGGATAAGATACCGGCTGAACTCCCTACTGACCGTGGGTTTCGGCACGAGATTGATCTCGTGCCAGGCTCGAAGTG
TTGTGTGACACGGCAGTGGCCGTTACCTCGAGATCAAGTCGAGGCTATTGACGCATTCTTCGAAGGACGCCGTAAGGCGAGTCACGTGCGTGAGATTATC
TCACCACACTCGAGTCCAACCTTCTACGTGAAGAAGGCTACGGGAGGCTGGCGAATAGTGCATGCGTTTAACAAACTAAATGATGCCACTATTTCTGCGG
AAACGCCTATCCCCAGGAAGAACATGGTGTTAAACGCCATGTCAGGGGGCGTCATCTTTAGCGCCATCGTTTTAGCCGATGGATTTTACCAGATCCTGAT
AAGAGAGAGCGACATACCACTCACAGCAATAAGTACCCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCGCCTGCCACT
TTTAATCGCATGGTGTCTCAGGTGCTGAGACCATTACGGGACTTTGCTCTCAGTTACTTCGACGATAGCTTCGTCCACAGTCGCGCTCAGGGCGACTTCA
GCGAGGTCCAGGTTCATCTTCAGCACTTGAAAAGAGTATTCCAAGTCATGCGAGAGAACAAGCTCTTTGCGAATCTCAAGAAGTGTGCCTTCTGCGCACA
GGAAATTCCGGTGCTGGGTTGCTGTGTGAATAAATCAGGCTTTCGAGCTGATCCAGAGAAATTTTCGTCCATCTGTTCTTGGCCCACACCCAAGAATCCC
ACGGAATTACGTCAGTGGCTTGGCTTGGCTAATTACTCGCATAAGTATACAAAGGACTACGCCGGTTCTATACAGCCTTTATCGTCACTTTTGAACAAAG
ACGCCACGTGGTCGTGGCGTCCTGACCTTAGGCACAGTGAAGAAGAGCCTGGCGTCAGCGCCAGTTCTGGTCCTATTGGACGACTCCAAGCCATTTCACG
TCGTATGCAATGCAAGTGATTTCGCGATTGGTTGTGCCCTCATGTAGTTTGATCATGAGGGCCATGAACGAGTCGTGAGCTATAACACACGAAAAATGAA
GCCAGCGGAAAAGAACTATCCAGTTCACGACAAGGAGTTGTTAGCGATGAGCAACGCACTCATCAAGTTCCGCATTCACCTACTCGGTGAACGCACGTTT
GGTTTGTACACTGATCACGCATCTCTGCGCACAGCGATGAAGATTCCGCACCTGTCCCAGCGAATGGCGCGGTGGCATCGTTTTTCTCCGAGTATAATTT
AGTCGTGCATTACAAGCCGGGCAAGAATAACATTCTTGCCGATGCTTTGTCGAGACGTCCCGATTATGATCCTCGGACGGCGTTGAGTTGTCAGACGACT
GACGACGAAGAATATGATGATCGTTGCGCGATGTGTGTGTCGCTGAACTTAATTCGGGCCAGTCCCAAGCTGTGCTTATTCGACGAAATCGTCGCGGCTT
ACGCGAATGATCCAGACTACGCCGATATAATTGCTTATCTGCGCGCACCCAGTGACGTTGCACTGGATGCTCTTTCGAGAACCAAGCGTGATCACATTCT
GCAATATAGTTTAGACGAGGACCTACTCCTGTACAGCATCGATCAATTCGATGCTCCTCGTACGGTGATCGCCAACGACATGGATTTGCGCGCTCGAATT
ATTCATGAATACCATGATGCTCCAACTGGTGGTCATCTCGGCCGCGAAAAGACTTTCGCGGCTGTGTCTCGTGACTTCTTCTGGCCCCACATGTACAAGT
GGGTGCGCAACTGGATTCGTACGTGTGAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCACCTCTGCGACCGTTGCGAATAGCAATTGAGGC
TTGGCGCTCAGTTTCCATGGATTTTATCTTCGGACTCGCACCCGATAGTCAAGGCAGAACGGGTATTCTGGTATACGTGGACAGATTTAGCAAGATGACA
CATCTGGTTCCTGTTCATGATAAGGTCACCGCGGCAGAAACCGCGGTGTATTTCATCGACGCTGTGTTTCGCAATCATGGATTGCCGGAGAACATTTTTT
CGCATCGAGATCCTCGATTCACATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAACTACGTATGTCGACAGCGGCCCATCCGGAAACGGA
CGGGCAAACCGAGCGAGTAAACTGAGTACTCGAAGATGTCTTTCGAAGTTACGTTATGTCCTTCACGAGTTGAAGTGCGTTCCTACCACTTGCTGAGTTT
GCGCTCAACAATGCTGTACATGCGTCAACAGGTTTGACGCCATTTTTTGTGAATTCGGCTTGACATTCTCGAGTTCCTACCATACTTGCCGTGGGTCGCC
CCACGGCTCCTCGTGACTCCACTCTGGGGTGGATGAAAATTATAAACAACGATCGAGTGCAGCCCAGAGTATTCTGAACGCGAAAGTCGTCACCCGATCC
AAGGCGAAGTCAACTATTGTGACGCCACGTGACGTGGCGTTCCCATTAGCTCGCTGGACTGCGCAGACACTGATTGAACCGTCTTCAGCTCAACCTGTGC
CTTCTCCGAAGGCCAACTATCCGCCGATTGAGTCGGCGCGACCAATTGATGACGCGGCTGTGTCGGAGTTCATACTCCAACGTCAAGCCATCACCCGATT
TGTACGTGACGCAGTTCAGGCTGCGGTGGACAAACAGAAAGAAAATGCGGACGAAAATGGCAGGAAAAACATGAACAAGTTCGTTAAAGGCAATCGTGTA
TAACTCTCTACAGATGGTTTAAGGGATTCGGCGGTTACTAACCTAGGCGCGAGCAAACCCGCGCCAAGCTTCATAGGACCATTCAAGGTTTTCAAAGTGA
TTGATGATGCCTACAAGCTGGAAATCCCCACGTCGCTGCGTCTTCACCCAACGTTCTACGTCGGGCGGCTTAAGCAGTA