Description :
From Genome Similarity Track
Location :
Scaffold_70:24209- 25616
Sequence
1407 bases(100 bases per row)
tcagagttagtgagcatcgaagttgctgtttgccgtgagtgtgactcacagggcgtgtgcggggtggcgcgttatccgccgagcggtgtttgtagggtcg
ctgacccgccgctgtgtcctatggacaaacgtggaacggcacgtaaaccgttgagcggtacttgtagggtcgctgacccgccgctgtgtcctaaggacaa
ttgtggaacggcacgtactccgttgagcggtgctcgtagggtcgctgacccgccgctgagtgtctcgaacgacattgttccctctccgaggagccatagt
gcgttggcacctaggcagcgcgacggtgatgtcgccctgcagccctcatccggccgtgctcgggcgaggaggaagaggaggaagagacgcagagtgtctg
tgacgtctatgacgtcggacgaggtgtccagcgtgttgagcggtgaggctccacgcgactgcagtgagcagttgtacacactcgtgaatggagtgacagg
ggatgtcgacggcgacataagtctcgagcgactcccgtcggttgatgctctgttagagctggacgagatgtccgtcgccgagtttggcgaggccttaaag
gccggcgagcttgccgaggtggtcatgatacgacccgaggaggagttaaactcctcgtccgtcgtggacgaagctgtccttgaggacacgaagcgagcgc
tgagcgctaggagtggatcttcgatcctccaggatccctcggatccgttttatcctttgatcaaggaataccacgatgtggtgtcgaaggacccgtcgtc
agggttgcctccggatggaggcgtacgtcatgagattgacttggctcctggaaccaaatactgcgtaacacggcagtggcccttaccaagggagcaatgt
gacgtcatcgacgcgttcttccgtgctaagcacgaagccggcttggtgcgtgagagcaagtctccgcactcgacacccacgttctgtgtcagaaagccca
atggcaagtggcgcatagtgcatgcttttaataagctgaatgcagccaccattccggcgcagacgccgattcctcgaaaggatgttctgcagaacaacat
ggtgggatgtacgttgtacagtgcactcgacttggtcgacgggtattatcagttgctcatgagagttagcgatatacccctcacggctgtgagtactccg
agcggtatgctctgggagtggttggtgatgccccaagggctgtcgaacgcgcctgcgacgttcaatcgtctagtgacgcagttgttcaggccccatcggg
cgtacgctcagacgtacttcgacgacatcttcgtccatagtcgtgcggagcacgggaggtctgatgtggaaaaccaccttgaccatttgcgagcggtgct
cgagtgc