Description :
From Genome Similarity Track
Location :
Scaffold_8:242079- 243227
Sequence
1148 bases(100 bases per row)
GGAGCACGCGGACGTGCTTCCAGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGT
TTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCC
CGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTGCAACAAGCTGAACAATGCGACGATACCGGCGCAGAC
GCCGATACCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGT
GAGAGCGATATCCCTCTCGCGGACAGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTGGTGATGCAGCAGGGTCTGAAGAACGCCCCTGCGACCTTC
AACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGAGATGAGCG
ATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGA
GATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAG
GAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACA
CCGAGTGGGTTCGGACTGCTGAGTGTCAGCAGGCCCTCGATGCAGTTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGACCGACCAAGATCGCC
CGTTCCACGTAGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTGTACTACCAATCGCG
TCAGTTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACT