Description :
From Genome Similarity Track
Location :
Scaffold_136:24205- 27893
Transcript NameFunction/comments
Physo_143332hypothetical protein
Physo_143333hypothetical protein

Sequence
3688 bases(100 bases per row)
TGGTCGGGTTTCGCCACTTCATCAAATTCTGCGACGAGGTTCCGGGACAAGGAGCGCGAGCCTCCGCTACGTCCCACGGACAGCATCGCATCTTCTTCAT
CTCCGAACTCCTGCGTCGTCGCTGGAGTCTTCTCCTCCAGGTCATCATAGTCCATCATCATGTCATCCTTGGCGTCCGAATCTTCGTCGACCGACTCTTC
GAAACTGACCGACCTTTCGGAGATCGTCGACAACCGAGACGTTAAGTCACTCGCGATCGTTGACGAACCTTCGGCGATCCTCGTCCCGACTTCACCGGCG
TAGCTGGTACCGCTGACTTGGATCCTTTCGCCATCTTGTTCTTGTTCTTGTTTCTTCTTCTCTTCTTCACTTCTTCTTCTCTCCTCAATGCTCGTTGGGC
AAAACCTACACAGACCACAACACACAATCGGTCACACCAGTCCTGGGTCGCGGCACCAGTTGTCGTGTAGGAAAACACGAGTTTACGAGTCCTCGCCCAA
TCAACCGAAGTCTCTAGGACGAGCCCTATCAACAACACACGCCGTCTCCGAAGAGTCGGCGATAGATTGTCGGGATAATAAACCTGAAGACCAGGTCCGA
TCCCTTATACGGGCTGGAATGTGCCTCCCTGTGTGTTGCGGGTCAGGTAGGTTTACCCTTCGTTAAAATATAAGAGCACCATTAGCCACGAGCCACGGCT
ATGACGCAATGTGTAATACGTGCTTTCGCACTAAACCTCTGTGGTCCCTCAGAAAGGAAGGGTACCAGGCCAATCGAAGCCTCGGCTAGAAGTCAAATAC
ATCCTTGCCTCACACCCAGTCAAACGTACAACTGTACACAGAGGTCTCTAATACCTCCCAACACTCGGCCACCTACTCACTCTTGGCCTTACCAGGATGA
ACACTCTGTCAATGCACCTTATGCTCACCGGCAGACATACCCCGTGCAGCCGAGTGTATCCAGACCCTACGCTAAGCTTAGCGACTTACCGTAGACGGAC
TTGACCCTTGTGTGGCTTGGACTGCAGTGGGGTTGCGCGAAAGCGCTACTTAGTATCCTAGCCTTAGCTCGTGTCTAGTGGTACATGTTTTTGGGGTTGA
CCGAAGACAACCTAAGGTGCACAGAGGCGCTTGCAACCGACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTTTTGATCCATTTAGCGCTTACCTTTGC
AGTTTGCGTGTTGTTGGTGTCTCTAATACCTTTTGGTAGAGGAGGATTTTAGTGGAATTACCACACCACAACTGGTGCCGCGACCCGGGATTGGTGTGAC
CTTCTGTGTGTATTGGTTGTTGTAGGTCTTTACCCCCAACGAGCGAAGAGGAGGAGGAGAAGAAGAAGAGAGAAGATGGCGAAGGGAGTCAAGTCAAGCC
AGCGGTACCAGCGACGCCGGTCAAGTCGAGCGGAACGCACAACGAGGCTTCGGTGCGCTCCGGAAGCTCGTTCTCGACCCCAGCGACGGATCGGATGGAG
TCGATCGGCGAGCGTTCGGCGAGCTACGAGACGGCGATTGATTCCTCGGACGCCAGAGAAGACGATGAAGATGATGACTGGGATGTCAGGACTGTGATGT
CCGAGACTTCGGAAGCTGCGGTTGTGTCGGCAGGCCGCAGTGGAGGATCGAGGTCGATCACCCGCGACCTCTCCGAAACGTTCAACGACATGCCGGGCCC
CGAGCCCGCCTGCGACGCGGATGGCGGTGCGACCGAGGGTTTCAAAGCCTCGGTGACGGTAAGAGGGGCAACTTCCAAGCCGGTTGGCACTCGTCCTCCC
CTCAACGGCGATACTCCGGCGGCCAACAAGGTTCTAGGCCGATGCCTGGAGCTGATGAAGACCAAAAGTGAGTGGATGCAGTTGTTCTCCCCGAAGCAGG
TCCGTCAGGCCATCTGGATGGACCTCGGAGGGGCTTTGGCAACGCCGATCAACTCAACGAGCATTCGGCAGGCCGCTCAGAACACTGTGGACCTCCTGCG
TGCAATGGGGTGCGAGCCCCAGATTCTCCCGACGGAGCCTGCACTCGCGAGCTGGACGCCAACCACCGCCGCCATGGCGCTTACCAAGTGGAGGAAGAAG
TTACGTGAGGCCTTTGGGGTGGCAGACCGAGGCTCAACGAAGCTTCGTTCGACCCCGGGAGCGGTTGACCCCTCCAAGGTCCCGCTACCAGCGACCCCTC
GGAAGGCAGCCACGGATGACGGATTCTTCGCAGTCAAGGGCGAGCGAGGCTTCGCCTTACATGCAAGACTCGCACATGGTAACCCCACGATCTACGGACC
GTACTGAACGTCTGGCTAGGGAGGCCGAGGTTTCGTACGCAACGCCTGGCACGCGCGGGGCAACCGGTCGCCGGTCCAGCCGCCGTTATGACCTCCGAGA
TGGCTCGTCGGACAGTGACGATGATCTCGGGTCCGACTGTTACGAGGGCGACCTGCCAAACGAATGGGCTCGTCAGGTGCGCGAACGGAGCGCGACTGAC
AATCATAGCTCAACCCCGAAGCTCGAGATTACCACGTACCTACCTCTCTGCAACATCAAGTCGTTCTACGGTTTGCGCGACAAGAGCGAACACTCCATGC
AGTGGCTTCGTACGTTCGTCTACGAGATGAGGGGGACACATGCACCGCCCAACGAGTGGTGCATGCCGTTCGAACTCAAGCTCAGAGATGGGGCTTTGTA
TTGGTGCCGCCAGCTTCCACGCAAGACGAGACGCACGTGGAAACAGCTGTGCGAGGCATTCATTAAGTACTACTGCTCGAAGTTCTCCCAGTCTGCAAAG
GCTTGGTACTACTCGGCCAAACGAGAGAACAAAGAGCATGTATGTGACTACCTCAACCGGCTCAACGGCTACGCTCACAACGCCGGGGTTCAGTTTGAGC
ACGGGGATCGTGACGCGAAGGACCACGTCGAACACTTCTTAGTTACGTGTGATGACCGAAACTTAGAAGACCGTCTGTGGCACGTTCGGGTCAAGAGCAT
TCATGTCCTCGAAGACATGATCAACGACATTCTGCGTCACCGCGACCAAAAGTCGACTCGCGAATCATCGTTCCACCGCTCCCGCAGTCAAGATGACAGA
CGCCGTCGCGACGCGCGGTCGAACGAGGATTCTCGAAGTGGTTACCGCCGTGAACGACGTTACCGCGACGAGGACCGCCGCGAACGACGTTACCGTGACG
ATGACCGCCGCACCGATCTTCGTGACGAGGACCGCCGCCGTGACCGACGTGACGAGTCACCGCACCGGTCGAGGGTGACTTTGGTCGATGCCCTTGCCGA
TGTAATGGCGGAATGGAACGTCGGAGGCTCGGTCGGTGCACGCAACGAGACTCTATACGCCCCCCGACGTGATGCTGAGGCGAACGAGGATTACTTCGAG
GATGAGCGCCAATACTCGGACGACCAACGCTTGGACGAGGATTCAGACGCTGATCTCGACTCGGATGGGTCTACCCGACTTGTCGCTGCCTCTAACAATG
CTGAGCGCAGGGCCGCAGCCGAAGGAATGTTCGCTCGGTCTGATAACCGACGCTTCAGGAACGGAGGAGGCCCGTCCAACCGTGAACGAGATGGTCGACG
CCAGTATGGACCGTGTGCCGCGTGCGGAAGCCCGTCCCACTCGGTGCACTTCTGCTACCGGCGGTGCAAACTGTGCAAACAAGTGCAC