Description :
From Genome Similarity Track
Location :
Scaffold_363:2420- 25628
Transcript NameFunction/comments
g17228.t1hypothetical protein
g17229.t1hypothetical protein
g17230.t1hypothetical protein
g17231.t1hypothetical protein

Sequence
23208 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCATCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGGGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATATATTTGAGGCAGGTTCCCACGTGGGT
TCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CACCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCGGGTGATAACCGACTCTT
CGGTCGGTCTCCGAACTCGCTGACGGCTTTGAGTCGGGACACGTGTACCACCGCGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCAATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGAGCGAGTTTCTTGGTCAACCCTGGCTTGAATCGTTCCATATACAACCAAACTC
TGCTCCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAGGTCTCGTTTTCGTCGAC
ATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCCTTCTCGACACTTTGGTACTCCATTGCCATTTTCCAC
GAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGG
ATTGTGCGTCCCACCCATGGACTAGGTAAAACGGAGTGTCCTTCTGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTC
CCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGTCGATAGCTC
AGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTC
CGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTG
GAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCT
GGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCCGCATATAGCCCAATCCAAAAAT
AGTCTGATTTGACTCGGTGGTAGGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGG
CACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTTCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTG
TCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTTAGGTCTGTTTCCTCGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCT
GGGCGGCGGAGATTCGCCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCATTGCTCGATTGCTC
GGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGG
ACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTC
CACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCCGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTC
GACCAATTCTAATTTTCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGG
ACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCTTTTCGACATGCCATCACCCCTA
GGGACTGCTGGATTGCGAGTCTCGAATCTCCAACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCCGAGACGCCGTTGTTCATTCCAGCATACTC
GGCGAGGTTTACCGTGGTAGTCTCGAGATAAGCACTCGCAGCCGTCACTACCGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCA
CCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGTGGGTCCATACGAGCAG
TAGGTGACCCTTTCGTCGGCGGTGTAACCGGGGCTAACGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTGCAATC
GCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTAGATTTGTACACCCATTCG
AGCGCCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCTTTCTCGGCCG
GGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCA
CTCATTTGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGC
TTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCATCCTTCAACTGATACAAAGTTGCTCCATAGACTGCGAAATCCTGGATGAATCGACTGTAAT
AATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTC
TGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGA
CGGTCTAACGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATTATCGACAAACGACCGTCGGTCGAACACTGGCACCAACAAGGATTCAT
CCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCGTTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGT
CAACCGAGTTGTTGACTCCTCGAGCCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAA
AAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATAC
GAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATTGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGTGA
GCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCG
ATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCAAGC
CTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGGTGCCCCTGTACGTCAATATCGCACACCAC
ACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTTGCG
CTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAAGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCACCT
CGATCTCATTCGCCAAATGTTCGGACGTATTGGTATCGGTGTTCTCACTACCTGAACCGTCCCCCGTGGTAATCTCATGCATCATTGCTACGAAGGCAGA
GTCCAATCGGGTCTCCGCGTCATCACCGAGGACTGGTGTGGATTCCTCTTCACTTGTATACGTGGTATCCGCATGTCGGTCGCCACTGAATCGGCATCCT
CGCTGACCCAACGACCTCCAGCGGGTTCGTCAGAGGATCGCATCGTAGTCGGCGGTGGCGTTCGGTCTCGTTCTGTCGGTTCCTCGGTACTCCTATCCGC
GAGCGTTATCTGGTCCTCGTTTCGGCCTCCCAGGTCGTCGGATGGTCGAGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCGTTCTACCGCAGGTGGC
TGGTCTGTCAACCATCGTTCGTAGAGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAGGTCTCGTCTCGACACTCTGCGTACGCCAGGACTTGCCACTCTT
CATACTTGGCGGAGTTCAAACGAGTGTATCCATCTCCTTGCGGCAGGTCACCCCTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAAT
CCTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGTCCCCATCGAGACCTCGTTATAGTGGGCACCAAGTTTCCAATCCGGCGTGCCCACACGTCG
TGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAACTCTCGCCACTCACACCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGC
TGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCGCCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCC
AGCTGGAATCATGAAGTCTGTTCCCAAGACTACATCAACGCCTGCACTGTGATCCATAAGCCATAGCTCAAATTCGTACACGCGCTCCCAGCCTAGAGTG
ACTTTAACGAGTGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTA
TGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTC
TTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGC
TGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTC
CGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGT
GGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTT
CTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAG
TGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACG
GGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTG
GCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCA
TCATATCCGTCGTTGTACGCTTCTGGGTATCCTCCACGCGCGTCCGCCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAG
TGACCCTCGGTCGATACTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCG
ATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCCGATTTTCGC
TCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCGCACG
AATCCAAGAAGTGTTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAACATAGCCGTTGAGTCGGTTGAGGTAGTC
GCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTTGCAGACTGGTTGAATCTCGAACAGTAGTACTTGATGAACGCATCGCTCAAC
AATTTCCACGTGCGCCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCGTTAGGCG
GCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTCCGAG
TGGGAGATGCGTAGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTTCCTTCAAGTCACCC
CCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAGCAGTCGGAG
CGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTATGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATATGTCGAGGTTGCTCC
TTTGGCCGAAAATATTCCGGCCTCGGTCGACTCTCTGGGGCGTCTCCCAGGGGTCAATGGTAACGGAATCATGGACGGGTCGACCGGATCCGATGCGTGG
CGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTG
CCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGCTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTATTCCA
CGACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTC
ATGAGTTCTAGGTATCGACCCAGAACTCGATTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCACCATTCGGCCGAGAATTCGCATCCTCGGCCA
TCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAG
CGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCTTCC
TTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCAAACGACGGACCGGAACGCCCCG
AACCCTCGGTACGCGTTCCACTTGACCTCACCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCTCTC
GAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAA
AATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCC
CTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGCCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAAT
ATTGCGCTTTCGCGCGAACCCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAA
ATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAAC
AAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGG
ACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATAT
CTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTT
TTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACACT
CTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCAGACCGTGACAGTTCGGCACCAAAACCCAACGCCACACAAGTCTCCTGCGGACACTGTGTCCGCGA
ATGACAGCTTCGCGGGTGGACAGAAGGACGGCGACGCTAAGGCAGCGTCGCCAGCCAAGCGCTTGACGCTCGGCGAGGGTCTTTAGCGAGCCCGTGACGC
CAAGGCCAAAGAGGCTGGGTCGAAGAAGCGAATCGCTTCTCTGTCCCTTCCTAAGGGCCTGACTAGGGAGCTTGATGTTATCAAGTCCCTGTTTGACTCC
TCGGAGTCAAACTCGGAGGATGAAGAGGGACACGTACATGTCCCGGAGGAGGTCGCTAATGCGCTCGATGAGCAGCAGGAACGCCTCCAGGAGGCCCGGA
TGCGCCAGTGCCTCCCGCCTCCGGCGCCGCAGCCAACTCCTGGCGGGGGTGCTTCAGGGGAGAGGGAGTCCAAGCACCCCAGGGGCTACTTCCCGCCCGA
TGAGAATACGGGTTCTCCGTTGTTCCTTGAGAGGATCGGCGCTCCTTGTGGCCTCATTGGAGGCCCCACCTCCCGAGGCGCGTATGAGCGCGACTTGATC
CAAAAGGTGGACATGTTCACCGAGGATATTGAGGCCGCTCGGTGCGTCCTCCTGGCTCCGCATCGGATGCCGCTCAAGGAGTTCACCACCCTTCGCAAGA
AGGGTGAGAACAGGGGTGGTCTCCGCCCGGTGTGGAGTTACCCTTGGGTCCAACCCGAAAACACTTACACCGTGGCTGTAGCGGGGCTATACAGTCGGTT
CACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTTGACCACTCCACAAGGTGGTCCACATTCATAGCCAAAAGCATATGACTGGTAGAA
AGTAACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTAGCACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACT
TAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGT
CCGTCCAACGACCGACTAACACGTTCGTATGGAATACAAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCTGTGGGTAGCCCAAACACGTCT
GCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCACCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCG
AACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGCGAAGCCGCTGCTCGAGCTTCGGTGTCGCCATCGGCCACA
CCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAAGTCGACACTGCCATTGCGG
CTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTATGGACGCCGACTCACGGACCC
TACGTGCTTCAGCACGTACGAAGAGTTCAAGGAGGAGATCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTG
CAACAGGGCAAGTATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGGTCGACGAGGCGACAAAGGTCGTCA
CGTTCATGAAGGGCCTTATAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGA
GTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGATCCCGAACCAATGGACCTCTCG
AGTGCGACCGCTGCTGGGAACCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTCGCGAGTGCACAGCAC
CTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAAAGGGACCAGCAGGCGCGGAGCGCCCTGCTGGTGAT
GCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTGT
CATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTT
GACTTCGAGGAAGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTACCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCT
CGTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTTGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGTCTTGCACGACATGATCC
GGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCACATGCACCACGTGGTGCA
TGCGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGATCATGTGACGGGGGTCACACGCACCTTAGCCTTTAGAGGAAGCGTTAACGCGCTAA
CCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGGGTACAAAACGACTTGCGAACTTCCAGGTTAGAGTTAAGC
TGTCTGTATTAATCTCACTTGTAAGGTTCTAACTGCTATAAACTATCTGCATACTGAACTCTTGTCTAAACGGACGATCTTCCAAATGGGTGGCCCCCAT
TTGATCCGCTACGGTAAGTCCGACTCCGTACCTAGTGTGATGTACACCATCGTACTTAACGTGCTGCCGAGTGCCACACACCAACTCGTGTGAAGTACGT
ACTCGTACTTAAGGTGACCAGTGTGAACCACACCGAAGAACAATGGGTCTCCCCCTTTCACAAGATCTTTTGCTCGGCAACGGTGTAAGCCAGCGTGACC
CTATTACACCCTCCCACACCCAAACGGGAAGCAAGTGTCCCAGGGGGAATCCAGCGACGAAGAAGGCCCTGCCTCATTCCGCATTTTGCGCCCGAGCGAA
CACGCACCGAGGATACACCAGGCCCAATGGGCACGCGACCGAGACGCCCACATCCGGGATGGCGAAGACAAGCGGAGCCAAAGCGCGTAGCGCTGCCGAT
TCCAAGAAGAAAGGCGATGCCGCCCAGGCGCAGAAGCCTCCCAAACACCCGAGAGCAAAGTCCGCTTCCAAGAAGCCGGGCGATCCGCCCTCTCGAGCCA
AGCCTACCAAGACCAAGTCCAGATCCAGCAGCAAGCGCACAGCGGTGCAGCTGCCCGGTCCGCAGGAGGCCAGCAGCAGCAGCGGGTCGGACACCGACTG
TACGAACCCTGGGCTCATTCTTGGCGACGCGGATAGCCCGGATGTCGACATGGAGGAGGTCCAGGAGCGGACGACCAGCACACGCCGTCGGTATCTACGG
CAACGCCTCCAATGACCTCGGCCAGTGGCAAGGAAACTCCAAGAGCTAGTGGCGGAGCCTCTACGCCCGATGAAACCTAACCGGATGCCCCCCGGGACTC
GACAAACGAAGGAGAGGCTCACAGAGCGCACGACGCCCCTGATTCGCAACCTCCGGACGATAAGCAGGCTGACGCCGATCGGGCTTCGTCCGTCACGGAG
ATGGAGATTGATCAAGGCCCGATTCGGGACGCGAATCGCTCGCCTCCGGAGGACGTCTCGAACGAGGTCGACTACGACGAGTCGGATTCCGAGAAGGGAC
TCGAGCAAGGGGAGGTCAACGACCCCAATGCTTCCCCGAAGATCACGGAGCAGCATCGCGCTCTCCATCCAGGAAGTCTCATGACTCCTCGCAGCAAGGC
TGCCGTTGAGCGCAACGCGGAGCGAGCGAAGGCCGAGCCTGCGCGTCGAATCACATCGACGGAGCGGGAACCGCAAGTCATCACCAACGTCTGTAGTGAG
GACGACGTCCCGCTTGAACTGCTGCAGCGCGATAACCGACAACATCTCAGCGAGCGCGCTCGAGATGTGAAGGTCGCCACCAAGCAGCGCCGAGACTCGA
AGCGCGATCACGAGTCTGCGACTCCTCGAACGCGAGAACAACTTCTCGCATTGCGATACCGGTCCTTCCGAGACTACAGCGAGTATCTCCGGCGGAGTCG
GGAACCTGGGCACAGGTTGCCGCACTACGACGAGTGTCCGGTCGTCTTGTACGACGACACGGGCCTGGCCCGTCAATCCAACGAACTTGAGTTCACGCAG
TGGCTACGCCACTTGGGATATCCCATGCCTGAGTTTCCGGATTCTCCGTATCGCCTCGATTGACTCGCCCAGCGGCGTCTTCGGTTTCGTATGGCGAAGA
TGGTCGTCAACGGCCAGTGGCGCACCCGCAGCTTCGACCGCAACCTGCCCACCCCGGGGGTCATCCTCGAGGAGGTCCTTCAGAAGGTCCAGAAGTCCTG
GCAGTCCCAGCCGATAGAACTTCGAAGTGTTCTTGGCCGGGTTAACGCCGACCGGCTCTGTGGGAACGCTCATAAGCGTCCACGAGGTCGGCACAGTCCT
CCGAGAGGCGGCTTTCAGACTCCCACGTGTTTTGATCCTCTGGATAACCGCGCCACTTCACCAGATACTGGTAGTGACAGATACGCCCGCGGCGCTTCAG
TATCCTCTCGACATGATAGTAGAGAGCGCCCTCATTACCAATCAGTGGGGGCGGGGGACGCCACGGACGTGTCGACGGACCCGGACGCCTCGCGTCACTC
GTCGACGTCGTACACCTCGACGAAAGACGTCTCGTCGGTCCGGGGGAGCCTCCTGACTGCTGTGGAGGGCTGCCAAAAGGCTGCTGGAGATGCAACGGAC
GGATCTTGTGTCCCTACGCGGTCGCGTGCATCTTGTCGAGTCGACTGTTGAGTCAAGACGGGACGTCCCTCACGATTTAGGTCGTCTCGAGCGCGGAGCG
AATGATCTGCAACAGCGGGTTGATGGCCTCGAGCAGGAGCTTCGTCAGGTCGCTCACCGCTGCTCGGAGAGCGAACGAGCCCTTCAGGAGGACCGCGGTG
CCCTTCGGGATCATCTTCACTGGATCCGACAGCTCTATGCCCGCGTTGGCGCACTGGAAGATCAGACCCCTCAGAGGGCCGCTGCTTCGCCGGCTGTTCC
AGCCCCACCCCAAGCTGACTTGATGCAGATGATGGCGAGCGTCCTTCGGCAGTATTCGAACTCGTCGGACTCTCAGAGTCATCTGCCTCAGCCGGGCGAT
AAGGCTTGAGCAAGCCCACGTAGAACGTTGGATGCGTGGCCATGGCCGATGGTAGGTCCAGCGTGTACGCGTTGCCGTGGACCCCAATGACCGTGAACGG
CCCCACGAATCGTGGCCGAAGCTTGGTGCTGCCCACTGCAGTGACTGCCTGGATAGGGAGATTCTTAGCGTTTAAGAGGACCTGGTCCCCAAGGTTAAAC
ACGTGCGTGTTCTTACGCCCTTGCCTGTCACTGTGTTCCTTTTGCGTGTCTTGAGCAGCCTCCATAGCGTCCCGGACGCGCTGTCGTACTGCTTCACCTG
TCTCGATGAACGTGAGGAGGTTCCGTTTGACGGACGAACGGAGGCCTTGGAGGCCACGCGATCTTCGGTGATAGCCTCTCCCACACCCAAACTCAAAGCC
GGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACGTAAAGTGGGGTGAAACCCGTCGACGAATGCACAGCATTATTCAGTGCAAACTCCA
CTTGGGGTAGCAGCGTGCTCCACTTGGTGGGTTCTTCAGCACAGACGCTGCGCAGTACGTCTTCCAAGACACGGTTCACGCGCTCCGTCTGACCATCGGT
CTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGTCGGAACAAGTGTGTCCAAAAGTGGGGCACAAAGCGCGGATCTCGATCACTCACG
AATGCCTCCGGGAGGCCATGGTGTCGAAAGACATTGTCGACGAAGAGCTGTGCCGCTTGTGACGCCGTCACGCTCTTCTTTACCGCGACAAGCCGCACCA
TCTTGCTCAGTCGACAGACGAAGGCCAAGACGCCAGTGTGACCGCGCGTGTCCGCCGGGAGCTCAAAGATGAAATCCATGCTCACCGAGCGCCAACAGTC
AGCCGGCACCGGCAAACTTATCAATGGAGCCGACGACGATGGGGCGGGCTTCACACATTGGCACGTCTCACACGTCTGCACGTACGTACGCACTCACTTA
TACATATGTAGCCACCAGAAGTTGCACGCTACAGACGTATACGTCTTCTCTCGGCCAAGATGACCGCTGAGCGGCGTGTCGTGTGCCTCGTAGAGGACTC
GATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGATCGACGCTTTCGTCTACCGGATAGTAGAGGAGACCGTCCGCTATTGAGTAGCGGTGCAA
CGGTGAGCGCTGCCGAGCTGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGGCGAGATCGCCATCCTCTGCGTACGCCTCGCGT
AGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGGCGCCGGGACAACGCGTCCACGAGGACGTTCTGCTTCCCTGGTT
TGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGGGAGAGGTGGGGCGACGACGTCGCTGTCCGCAAAGACGCATG
ATCTGTGTAGATCACAAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCATCGCCAGAAGCTCCTTGTCATGGACAGGGTAG
TTCTTTTCAGCCGCCTTGAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACCTGCAGCAGGGCACAGCCTATGGCAAAGTCGG
ATGCGTCGCATACCACACTGAAAGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGCTGTTTTTGATTGCCTCGAAAGCCTGCTGGTC
TTCATCGTTCCACGACCATTCCACCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTAGTTGGCGCTGTACTTGTGTAAGTAGTTGGCA
AGGCCAAGCCACTTGCGCAAGTCCTTCTGAGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTACCATCCTTGCCAAGGAAACATCC
CAAGAAGGGAATCTCTTCTGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTATCGCGCATGCACATCAATACCTCACGGAGGTGGTTAACG
TGCACTTCGACAGCCGTCTTACCTCCTGAGGCACGACTGTGCACGAAGATATCTTCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAG
TCACCAGTCGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGCATCCCGCTGGGTGTGCTCACCGCTGTGAGCGG
GACGTCTGATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTG
CGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTACCATACGCCACTTCCCATTGGGTTTACGCACGCAAAATGTCG
GAGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCGTCGATCACATCGACTTGCTCCTTCGGTAGTGGCCA
TTGGCGCGTGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACGACA
TCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCGACGGGTCTTTCAAAATGGCCGCGCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCCTCCA
ACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGACCGAATCGAGTTCGCGACGGATCAGGACCATCTCCTCGAGCTCGCCCGCCTTCAGGGAGTC
GAGAAACTCGACATACGAGAGCTCCTCGAGTTCCAGTAGCTCTGCTACCGTAGGCAGAATAGCTAACCCCCCGCCGTCCTTGTACTCGCCCGTGAGCACG
TCCAATACCGTTGGTCCGACCACCCTATCCGAGGGGTCTGCAATGCGGCGTACTACGCCTGGACGTAGTCCCGCTGCAGTTGTGCCAGCCTCAGCGTCTT
CCGACGTGGTAGTCTCTGCTTGACCACACGTCCGTGCGCGAGCCCCAGCTCCAACGTCTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGT
GGGATACCCCGCTCGACCACTCTCAGTTGCGCGAGCACCAGCTCTAGCGACTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGTATGCCACCCGCC
CCGTGGACAAAGGCGACGTTCTCGTTCTTGAGAGTTTCATGAGCCTCATCCTGAGGAGCACACAAAAAATCCCATATCTTCTCCCACATCCACCGAAGGC
TCATGAGCTCTCGAAGATGTAGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTGCAGTTCGCCGCGTGGCACAC
GATGTTCATGCACAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGGCTTGTGACTAGCACCAATGGTGCGACTTCG
CCAATCAATCCACGGCTCATGTTTAGCAAGCCAAGGCATGCCGAGGATAAGATCGTACCGATCGTCCATGTCGAGGACAATGAACGGTTCGACCGAGTTG
AAATCGTCAAATTTGACGTTTAGGGATAGAAGGACCTTCCGTGTAGACACGATGGATCCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATG
CTTCCAAAGCACTAGCATACAATGCACTGTTCCTAGCCACACTGGACTTCGTCGTGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTC
GTCATATCCCTTAACGCTGGCTGTGACAACCACGAGGTTAGACCGCGCGGCGGCCACGGAGAGACACAAAAGTGTCGTCCCTGGGACTTGCTCTCAAGGA
GGTGGAGGTAGCAGAGCTACCGACCTCGAGGAGGAGCGATGTCTCCCAGCAGGGCGTCCCGCGCCTACTGGGAGTCGCCGTTTTTCGACACCGCAGACTC
GATCACATTGAGTGACGGAGCGGCCTTGCCGCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAG
CGACCACTCGCGCGTTGATTGCGCTGGGGACGAGCCGACTCGGCCGACGAGATCTCCATAGGAGTGGGACCTTCCGTCGCCTCTGCGCGACCCGCGTAAC
CCTGCGCCGAGCGCACGCAATGATCTTCCAGCATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGACC
CGGACGGACGCCATCCATGAAGACCGTCACCTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCCTCAAGATTCTGCAGCTCCATGACGTAGTCT
TGAAGCGTGCGCTTTCCTTGCTTGCACCGCAAAAAGAGTGATAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGC
CCACGAGGTGAAATACCCCGGAGACGAAGTCTCTCGTGCCATCGCTCATGCGCGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTT
GACTCGTAGATCTGCCCAGCGCTCAGCGCTATTTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTGCCGTCGAACGTCGGTACCGACATCC
TGAGGGGCTTCGTAGTTCTTTGCCGTGCGGCGTATGAAGCAGGACCCGAGGGGTTCGCATGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGCGCGAGC
AGCTTCCTGTGCTGCAGTACTCACGTGAGCAATCAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGAAGGTTGGTG
ACACGTGGCGACTGGACGTAAAATGTCCGAGCGTCGTTTCCCATTTCCCATGGAAGCACTCGCGGTGATGATTGGTCCAGAAGTGCGCGCGACAGGGAAG
AACGAGGACGAACGGAGAACTGGTACAAGTTCCCACAGCATACTGAGACCAAGTGACTTCTAGAAGTCCTCCCAATGTCGAGTTACTTCCGGAAGTCACG
TGTGCCTTCCGAAAGTTCCTTCCTGATGTGACTCGCAGATGACCCAGACGTTGTGGGTGCGGAGGCTGACCAGACGCCCCTGATTTGTACCCACCAAGAC
CTTTCCAATTTTCCAGTATACAAGGCCCAAGATATTAGCGACCGACCAAGACGACCAGCCGGATATGTTATGCACGAAGAGCCGGCTTGCGACCAGGATG
TGTCAGCCTCCCGGATGCTGATTACGCCAAAGGAACCCTATAGTGAAACCAAGACAAATGTGCATGTGGAAGACTTCCAGCAGAGACCTTTACAGAAGAC
TTCTAGCAGAGACTAAAAATAACAGAGAGTTCGTTTTGCCACCAAGGGCGCAAGTGTTTTCCAGGGCCCTTATCAGTTGGCCTGGAAGCACGCTGGGATA
ACGCCGGACAAGCCGCCGTGTATTTCCGGGGACCCGGGTTCACCCAGCCTGCGTTTGGACGCGTCGTGATCGCGAAGACCGCCGTGGAACTCTCCGAAAG
GCTCAAGACCAAATTAGGCGGTGACCGAGTGACGCGCATTCGTACGTGATCTGTCCTATTTCATATTTCAGTTGGGAGTGTGTCCTCTAGACCCCCCATT
TCATAGTAATTGCCGTTTCAGGAGGTTGTTAGTAGTCACCCCCCGGAATTTGATCGAATAGACTGCTGTGTGATAGGACTGTATATTGAGTGATCCGGAA
GTGTTTTTTCCTTTTGGATATATCTGAAAGTTATCTTCTGGAAGGAGTTATAAATCCTCCTTACTGGAAGTGGTGCGCAACAAGGGTGCATCTGGAAGTG
ACCAGTCTTCCAGGTGAAACACAAGTAGACTGGTGTACGGACCCACTGCTCAATGGTCCAAAAGAATAAGTAGCAGCTGTATATTGTGTATAACTCTCTG
TATTATTTGGTCTTCTGGGGAGGCTTTGCTAGTGGTCTAACCCCAGCTGTACTAATTGCGTCGGGAAGTGAACGTACGCACTCTGTATTCTTGTATTCAT
TTTGATTGTGTAGGAACAACTCATCAGGTGGAGTCCGGTCTTCCGAAGACAAACGACACCTATAGGGATTACACAAGGTCACACGCCAAGCTACTTCCGG
AAGTCCCGTACTTTTGGAGGTAGTCTGACCCCATTGGGCTTTCCGAAAGGCGAAGTTTAATCTTCCTGATCGGCCGAGTCTTCTGGCGCGCGTGCGCTAT
ACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAGCTGGTGCGCGTGCCCGGATTTGGACGTCTAGTGATTTCACCGAGTTGTTCTTATATTATT
GATTGAGTTCTAGGGGACTGGGTGCTAACTAATCTTCTAACCGTGGTTATTATGGCTGGAATTGAAAGCACATGCGAAGGTGGACGTGAGGGATCCGAAC
GCGGCGATGCGTCCCGGTCATCACGTCGAGTACAAGGGCTGCCTCCGGAGGAGCAGGCGACTTTGGATGAGGTCGTCAGGAATGCTCGGAAGGTGAACGC
TGCGAAGCGCAAGGCTGCCCAAGAAGCGAAGGAGTCGACGGCCCAAGAAGAAGACACTTCTGAATCCGCCGTTCAGGAGGCGCACCAAGCGAATCAGGAC
GGTGATGTGGAGGTGCTTTCGGATGGGGAAGAAGACTCCGAGTGGTCTGGATCGGAATCCGGTTCTGATGACGAAAATGATTCCAGCTCGCAAGAGTCTG
ATGAGGCGTCTGAGGGAGACGTCGTGAAGGTTGAGCCCCCGGCAGAAGATCGAGTTTCGGACTCTCTTCAGCCGGAAGAAGAAGTTGAAATTCTGGATGA
CATCAAGACATCCGAACGAGCGCAAACGATCAAAGAAGAGCGGCCATTGTCGACTGTTCAAGAAGATGCTGTGCTAGAAGATGTGGAGATGTCTTTGCCT
GTGCGGTCGGATGTCCAATTGCAGATGGAGCTTCCAGATGTCGTGTCGATGCAGTCCCCTCCAACCGCTATGCAGAAGGATTACCATCCTGGAGTTCAAG
AAGTGGAGACTGGGACGGCCGACGTTCAAATAACGGAGGCCCAGGCAAAAGTGTATGTGGCAGATCAAGTTCGACGTTGGGAACGTGATGTTTCTGAAAA
GAATGTCCCTCCGGATGTCAAGTATGATTGGCCGCAAGTGCGTTTGGATTCCGAATCGTTTATGGTTGCTAGTCTGACTACTTCGGATTACCTGATACGA
CGGATGTCGATGCCGACTCAAGCGGACGCCTGGATTGCGGAGATGCAGTTACGACGTCGCACGTTTGGAATGGCCCGAGATCTGACCGCCGCTCTGATTC
CTCCTGGAATGTTCACACCCCGGGATTGCGTTGCTGTCTTGCAGACCATCCTTTTCGAGGCTGGTTTCGAGTTTGTCAATTTGGTGCCTGGATGGTTCCG
GACGCGAGTCTACAAAGTGCATCCGGATCTTGTCAGACGAGTGGTGGGCGAAATGCTGCAACTACTTGTGGTGGAGTTAATTGAGTGGAGACAGGTGGTG
AATCAGGCTCAAGAGTTTCTAAAAGTGCTGAGTCAAGCTGCCCCTGGAGATGCTGGTCGACTGCGTCTTGAAGTTGCCGATCATTTTCCGCCTAGAATAG
TAGTCGCGACGGATCACGAGATCAATCTGTTGGGATCGGAATATGTGTGGCATTTGAAAGCTGCCGGTTTCCGGAAGGTGCGGAGTCCACGAGGGGTTGC
GGATGAGGAAGCTGCGTCTAAACGTGTTCAACGTGTGGCTGCCCGACCGCCTCCTTCATCGATCCCGTCGCCGTCATCGCTCCAGTCGGTGCCATCTTCG
GTTGTCCAGAACCTGGAAGTGTTGTCCTCCAGAAGCAGTTTGTCCTCTGCCCAGAATGTATCCGAACGAATTGGCTCGGATTCTACGCCGAGTATGTTTG
AAACTTCCGGAGGGTCAAGCGAGTCGATGGCTAGTGCTACATCCAGTTCACGGACTTCCAGAGATAGTTCGTCTGGATCTTCTGGATGGAGTGTTGGCCA
AGGTGCAG