Description :
From Genome Similarity Track
Location :
Scaffold_751:242- 2146
Transcript NameFunction/comments
g15943.t1hypothetical protein

Sequence
1904 bases(100 bases per row)
GTACAACACCTGTTTCCGTCCGCGTAATCCCGAATTCCCTATGTTCGCTCCCGAGGGTATTTCGATCGGTGAGATCGAGCTCGATCTCGAGGAGGACGTG
GATCCAAATGAACCAGGCCCTCCATCTGTCGATGGGAGTGCGGCTCCTCCCGCTAATCGTGCGGACATTCGCATATTTGAAGGTATTTTCGACGAGTCGT
AGGTCGTCGAGTCGCAGACTTCGTCTGGTGTTCTTCATCGACGAGTTGTCTCTTATTGCCAAGGCCCAGGTTCTTTTAGTCGCTGATTTCGATGAGTCTT
GGTGGTTCTTTCTTGTTTCTTCGTAATCCATATGTCATCCATTTCGTAATATCAATTTATGCAATGACGCAGTAGCATTTCCATCCCTCCAACCTGCCTG
CTGTCTTCACAGGTTGGTAGTCAATCTTCGTATGCAATAGCCTTTAACACTCGTCTGCAACTTGCACCATTTGCAGACGGTTTTCACGTTTCTTCTGGCG
AAGGTAATCGAACAGAAGGCCTCCGCACGATAAATTCGACAAGGGTTCCCACGTGGGTTCATCATATCCCACCCATTTTACTTTGAACAGACGCTGAGTT
CGGTCGGTACTCGTCGAAAGCGGCATTTCATCATCGAGAATGGCTTCTACTTCATATCGCCCAGTTCGTTCGTCAGGTTCCCAGCTGTCTTCCGGCAACA
ACTCCTCGTCAAAGTCAAATCGATCGTTTTCGCTGAGACCATCTACTAGCTGAGTCGTGGGACGTTCGCTGAGCTCAGTCACCTTCTTCAGCCGTGATAC
ATGAACCACGGGGTAGAATCGATAACCGCTCTTGTCCGGCAGTTCTAGCTCGTACGCGAATTCTTCTACCTTATGCTTGACCCGGAAAGGTCCGTGCCAT
CGGTGTGCAAGTTTCTTCTTCAATCCGGGTTTCACCCGTTCCATGAACAACCAGACTTGGTCTCCTTCTTTGAATAGGGACCGCACGGACTCAGCTAATT
CTTCGTTCGCGCTTGCAGTTGCTGTGTCATCTCTCGCTGAGTTTGTCTTGGCTAATTGTCCATTGTCTTCGTTACTCGTTGAAGGAACAGCTCCTTGTTC
CGCTCGGCTCAACGATTCGTTATGCTCTTTGGCTCGCCGGGCTTTTTCTTTCAGTTGGTATTCTTTGGCAAGAATGAGCGCGATCTCTCGCTGCCGGTTT
GCTTCTCTGCGCCATACTATAGCGTTTGCTGACGTTGTCTGTTTCGCTGGGCCTTTTGAGGCTCGGCGAATGGATGAAGTCATCGATTTTAATGTAGACT
GAGCATCCCAGCCGTGTACCAAGTAAAATGGCGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGGACGAGTTTTTCTGCGATGTCATCCCA
ATCAGCTTGTAACGGGTCCTCTACGTAGACTCGTACTGTCTGGATCATCGTCTTGACGCTACGCTCTTGTTGACCATTTGCTTGAGGTCGATAACTCAGG
GTGGCTCGTGACCTAGACTGCATCATCTCAGAAAACGTCTGGAAGACTTCGCTCATGAACCTTGGATCTCTATCATGTCGAATGAGCGAAGGAGCTCCGA
ACCGACGAAAAATGCATTCTTCAAATGCCTTTGCCACTTCAAGTGCCCCTGTGTCGCTCATTGCCTTGGCGATCACAAATCCAGTAAAGTGATCCTGGAA
GAGAAGCAGTGCAGTGTTTCCTCGCTGAGTCTTTGGTAATGGAATAACGAAATCCATGGACACGATCTGGAATGGTCTGTCTGATACTACGTTACCTGGC
GAATATCCTCGCAAGTGGGGTTTACTCTTGCTGGTATTGCAGTCTTCACATGCTTGGACATGCTTGACCACATCGGCATACAACCCAATCCAATAGTAGT
CTGT