Description :
From Genome Similarity Track
Location :
Scaffold_662:242- 1411
Transcript NameFunction/comments
Physo_145230hypothetical protein

Sequence
1169 bases(100 bases per row)
TTTCGACGACTGCAACTCCAACCATGGCTAACGGCGGGAAGTTCCTCACCACGGAGGATCTCAAGATTGCTCTCAATATCTTCTGATGCGTCTACGGCAT
TGGCACGCTCGGTATGCCTGGCAACTTCGCGCGGGCAGGGCCCGTGATAGGCGTCATCGGCTTGCTCTTTATGGCCTTCGCCAACGTGTATTCATCTGTG
GCTATCTGCCTCGTGATGCTGCTGGCACCTAAGAGCGTCAAGACCTACAGCGACCTGGGCGAGTGGTGCATGGGCAAGTGGGGCCGCTGGTTTGCAGTTG
TCTCGCAGATGGCGTCGTGTCTGCTGGGGCCATGTGTATTGTTGGTGCTTGGTGGCACACTGCTGGACGGCCTGTTCCCGGACGCTTTTAGTACTTCTTA
CTGGATCTGCTTCATGGCGCTCATGTGCTTGCCCGTATGCCTCATCCTGACGCTCAAGGAAGGCGCCGGGGCCGCGTTTGCTGGCTGCGCAGGAACGCTC
ATCGCCGATGTCATCGGTGTTGCCGCTGTCATGTACGGCATGCGTGGCCACCCCACGCCGCCGTCGCCTGCTATCAAGTTCTCGCAGGTCGCGGGCATGT
TCGGCAACCTGGCGGTCGCGTACAATGCTGGCATCGTGATCCCAGCCCTGCGGCGCCAGCACAGCGAGCCGACGCGCATGCCGCGCGTTGTGTTCGTCAC
CATGGCCTTCATCTCGTGCCTCTTCCTGATCCTGGCCAGCACGGCGTACTCGGCGGTGGGCTGCCAGATCTCGGGCAACCTGCTCTACTCCATCTACCCG
GACGCGGACACGGGCCTCACCACGCTGGGCTTCAAGTCCAACTGGGGCGCCGTCGTCATGGCCTACTTCTTCATGCAGCTGCACATTACGATCGCCTTCT
CCGTCATCCTGAACCCGGCCTTCTACCTCGCCGAGCGACTGGTGCTCAAGATGCACAAGAAGAAGGAGGACGACGTCGAGAACGCCCTCACGTACGCCGC
TGCCTCGTATGAAGCTGCCAACACGCCAAGCAAAGATGCGATCAACGATGGCCGCCGCTCATCCAGGGTGTCATACATTTCCAACGCCGACGCCGAGAAT
CCCTACTACGGTGACATTGATGCAGAGGTCGCGGAGTACCGTGGCTCGAACGCGGTCAAGTATGCTATT