Description :
From Genome Similarity Track
Location :
Scaffold_2362:242- 1279
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2362-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1037 bases(100 bases per row)
CGAGCTTGCCGCCGTACCAGAACACTAGTGCATAAGTCGCGAGCACGATAAACGAGCTGAAGCCGAGCACAGCGCCGTTCCAATGTGCCTCGCGAACTCC
GCTTGCCATCGGCTGGGTCAACAATTCGTCGAATTGTCGAGAAATCGGCTGTTCCAAACCGAATGCGGTCACCGTTCGGATGTTTGTGAGCGCTTCAGAG
GCGTGGGCTCCGACTTCGCCGAGTTCGTCCGACAAATTGCTGGCCTTGACGAACTCACGGATGCGCAGTGTGTGACCGAGGACCAGAAATGGCGCGACCA
CAAGCATGACGCACGTTAAGAGCCAACTCCCGGTCGTGAACGAGATAATCAACGCAGCAGTCAGCGTGAACACGGCTGAAACGAGCCGACCCTGCGAGTC
CCCAGATAGATTGCCCACTTTGCTCGCGTGCGTCGACAAATCCGCCGTCAACGCGCCGGTCGCGTGCTGTTTCTCATCGAAGAATGCTGTGTCTTGGCGG
CACAGCGCTCGGAAATGCGTGGTTCGCAGATCGGTCGTAATCTTTTCGGCAAGAAATCGGAAGCAAAAGTTCTGGACTGTAGTTGCTACGAACAATCCCA
CTGCGCCAGCGATGTAGCCGACACCGTAGACGGTGATGTCGTGTGCCAAGGCATCCATTGCCGACTGGAGGTGGTGAGCCTCAAAGTTGGCGTACTGCGA
AGTCATGCTGGCCACCATGCTGCTCTCCAGCACCGCTGAGAGAGGAATTGAGGCTCCACAAGCCGCTGCTGCAATGATACCAGCCGCGAAATGTCGAGGA
AATGATTTGTTGAAGCTGAACGCATACCACATTGAGAATCCATCGCGTTCGTTTACCGTCTGGTCTCGATCGCTTGAGTTTCGGCCATCAATGCAGCTTT
CAGGGATCATTTCGAGCTTGCTGGACGGTAAATCATCGCAGAAATTGGCATTTGATCTTGTTGTGCGTCCTTCGACTTCTTTGCTTCCTTCTTGAAGTTC
GTACATGTTCAGGTAGACACCATCTTCAATCGACACC