Description :
From Genome Similarity Track
Location :
Scaffold_1515:2419- 4295
Sequence
1876 bases(100 bases per row)
GCTGTCGTAGAGGGTGGCGCCGACGGTGGTCGACTGCACGATCGCACAGCGCGCCTTGCGGGGCTCGTACTGGCTGCTGCTGCTGTTGTTGTTGACCGGC
ACCATGACTTCGTGTTCGCGCTGGAGCGCGAGGATACGGTGGTGCGACAGCTTGCGCGCGTGCTGCGCGAGATTGTTGGCGTACGCAGCGTCGTCGATGA
TGTTCTGCGAGCGCAGAATCGCGGCGTCCAGCTTGGCCTTCGTCTCCGAGCTCATCATTGGGAATGAGTAGCCATTGCCATTGCCAATGCTGTGGTTGTT
CTGGGCGATCTTGGACTCGAAAGCGTGGTACTTTCGGCCTCGGATGCCTTCTTCGATCAGCGGTTGTGTGGCTTGCAGCGGCGTCAAAAGGCTGTTGCTG
CTGGTTTCTGGATACTGTCGCCTGGATGAGCGCGTAGGCGACTGCGACGAAGTCGGACTGTTCGACGACGCTGACGCCTCCGAGTCGGTCTGCGCCGACG
CCGAGAAGTACTCAAACTGGCGCAGCGACTCTTCCGTGTCCGTGAGGTCGCCGTCCTCGGGCTCCTGGTCGCAACTCCCCATGCGCTGCTGGTGGTGGCG
GAACGCTTCAATGGAAATCGCCAGGTCCGCGGGGCTGCCGCGACGGCGCGACGTGAAGAAGTTGCCCTTGCGCATGACGAAGCCATCGCTCAGCGACCGC
AGAGGAAAACTGGCTTTTGGGATCTCGACGATCTCCGGACTCGACGAGAACGTCTTGTACTCGATCAAGCGATTGCGCACAGGCTCCAAGAGGTCGTCAT
ACGAGCGGCGCTTGCCGTTCGAGAAGCTCTGGGTACGCGCGATCTGGCCCGGTTTCCCAGGTGAGCACGGCGACCGGGTGTTCTGTGTGGAAGAGGACGA
AGACGAAGGCGCCGACTGCGGCGAGTCGGTCGCGTACCGCGACGTGCGGCGCACTTCCAGCACGCACGCCGTGCATACGCGCAGCTGGCGCTCGCCGTGC
TCAGGCACTAGCGCGCAGCGGATTCGGCTGCAGCTGCTGCAGATCACTTCGCCGCACTTGAGGCAGTTGTAGCGGCGGCGGAGCACGCAAAAGTTACGCT
CGCAGACCTTGCAGTAGTCCTGCTCGCACATGGGCATGACCTGCTGCGGGAGCACGATCGTCTCCTTCTTGGCGCGGAACGTCTCGATGTACTTGAGGAT
ACCGTTGATGCATTTCTCAACGTGGGACTGGACTGCCGAGTTCGCGGCCCACGCGGGTAGGTCGCCATTGTCAAAGTTGCACGTGTACGTCATGCGCAGC
TCGCCCGGTTTCTTCGTGGTATGGTACATGAAGCCCATGAGCGGCACGATGTCGCGCGTGTACTTGGACGACTCGGCGTATCTGGAGCTCTTGGGCACAG
CGACGGACTCCATGATGCGGAATGCGATCTTCTGGCCCTGGTCGTCCTCGATCATGTCCACGTACTCGAGGATGGCGAAGTCTCGGTCTTTCGTGAACTT
GCTCGAGCTCTTGAACGCCGCCCACTTGAGCGCCACGTACCGGTGCGGGTTGAGTTCTGTCGGCTCGACGATGTTCTGGATCACGGCGCCTTCGATGAAG
TCGGACGAGAGCAGCTCCATCATCTTGGTGTACGACTCGGTCGTGCTCGTGATCATGGACTCGGCCACGTCCTCGATCTCGCACGTGACCTTGCAGACCG
CGTGCACGTTGCAAGGCACGTTGTTGCCCACGTCCGCACGGAAAAGCGAGATGCCATGCTTCTCGTGCACGAGGCACCACGGGATGCCACCAAGCAAATC
CGTGGCCTCCAGCAGCGACTCGGTCATGCTCTTGGCCACGCTCGTGAGTCTCTCCATCTCGCGCACGCTCATCTCT