Description :
From Genome Similarity Track
Location :
Scaffold_182:24185- 26089
Transcript NameFunction/comments
Physo_144363predicted protein

Sequence
1904 bases(100 bases per row)
GTTCGGCAATCTGATCGGCGACGGCAAGTTCCTCAAGAGCATCTCGTGCAAGTGCGACGAAGGGCATCTGGTGGTGAAAATCTACCGCAAATATGACGAG
AGGGAGTCGCTCACGAGCGCCGAGGTGGCGCTGCGCCGCCTGGCGCTGGCCTTCTCCGTGGAGCAGCAGCCCAACGTGATCCCGTACGCCGACTTCCAGC
TGTCCAACAAGTACAACGTGGCCTTCATGGTGCGGCAGTACTTCGCGTCCAACCTGTACGACCGCATCTGCTCGCGGCCGTTCCTGACGATGGTGGAGAA
GAAGTGGATCGCCTTCCAGATCCTGCGCGCGCTGGAGCAGAGCCACGCCAAGGGCATCTGTCACGGAGACATCAAGCAGGAGAACGTCATGGTGACGAGC
TGGAACTGGGTCTTCCTCACGGACTTCGCGCCCTTCAAGCCCACGTACATCCCCGAGGACGACCCGGCAGACTACAACTACTACTTTTGTGCTATTGACG
CGACGCGACGAGGATGTAGCGTGGCTCCTGAGAGGTTTTACGGTAAGGGATCTGCGTCAATGGGCGTGGCCACGGGCTCGACGCCCGGCAGTGTTGGGTT
GAACTCGATGAAGACGCCGGACGCGGCTATGATGCTCTCCAAGATGGCAGACAGTGAAGTTACGGTGGAGGAGGTGGACAAGCAGATTTTAGCTATGGGC
ATGGGCAGCGCTATCATGTCGGGCAACCCCATGCAGACGCCACCCTCTGGTACGTCGATTGGCAGCGCGCCGTCGTCGTACTCGCGTTCGCGCCGCGAAG
GCAACTTGCTGGAGTCGATGGATATCTTCTCGGCTGGATGCGTTATTGCGGAACTGTTTTTAGGTGGTAAGCCTCTATTCGACTTGCCGTCGCTGCTTAA
GTACCGCACTGGTGATTCGGAAGCGCTGCGACAGCAGCTAAAGAAGGTCGGTGACCCCAGACTTGAAGAACTGCTGCTGCACATGCTGCAGCTGGACCCG
AGCGCTCGACTTTCGGCTAGTGGCTATCTCGCCAAGTACACCAGTCCAAGTGGATTGTTCCCGACATACTTCGACAATTTCCTGTTCAGGTTTCTGGTGC
TGGTGCTTAGTCGTGGAGGAAAAGTGCCTGATGCACGTATCCGGCTGGTGTGCAAGTACTATGGACGTTTGGTACGCGAGGTGGCTGGTGTTGAGGACCC
CGAGGGTGAGGAGTTCTTTAAGTTACGCCTCAAGGAAGGCTATGGATCGGACCGATTAGCAACTGCCACAGGAGAGCAACAAGCGCACGTGGCACAGCGG
GTACTGGAGGAGCTGGATCAGAAAATCCCAACCAAGCAGGAGAAACAAAAGGCTGAGCGGGAGAATGGGGCACTCACGAAAGTTCAAAAGTTGAAAGACA
AGGAGAACGACATGCGCAGTCTCAGCAGCACCGCGCAGAAGAAGAAAATCGAAAAGCTCCACGACCAGTTCAACGCGCTTGCGCAGAAGAAGAAAAACTC
GCTGCTTCTCGATTATCGTGAACCATCCGCTGGCCGCTTGGATGAAGAAGCAGAGGATGCTGAGTCGAAGGATGGTGATGGGCTGGGCAAGTTTGACTCA
AGATCTAATATTTCCACACCCCCTCCCCACTCGAACAATTCACGACGGATGAAGCCGCCAACGTGTGGTAGTGAGCCGTGGCCACAAGACCGGAACGGTA
TTGTTATTATCCTTTCGCTAATTTGCTCAAGTCTACGACATGTGCAAGTGCCCGAATCGAAGCTCACGGCGCTGTACCTGATCCGTTCACTGGGTCAGTT
CACGAGTGATGAAGCGCGATTGCAGCGTCTGATCCCGTATCTTCTCGAGGTTATTGATGACCCCAGTGCCACTGTCCGCGCCTTGGCACTCCGCACCATT
ACGT