Description :
From Genome Similarity Track
Location :
Scaffold_34:24180- 25182
Sequence
1002 bases(100 bases per row)
ATGCTTTAGAGCAAGTTTGAGCAACGGCTTCTTCAATGTCTGCCTGTTTAATTGAGGTTTCTGTTATAAGTTATCATGTAAATACCATATTCAACTCAAT
TACATTAACTTATGCGATGCACACACCTTCAGACTTCCTAATGTAAAAATGCACGTACTACACCTTGTTCAATTAGTCTATCATGTATCTGATGCTTAAT
CATTAAAGGCTTGGCCAAATTTTCTGGTACCACTAATAGCTGTACATACCTACGCAGCTCTGCAAATTGCTGATCTGGCACGCAGGTTTGGGACCTGACA
AACAAGCTTTGCCTTCTTCTCTGAGACTTAAAAGTACGTCCAAACCCAGCTTGTCTTCTTGACGCCCTTGGTACTGGCAACATCCTCTGTTTGCTGGCAA
AAGTGTCGGCGGAGGCGACCAATAATGTAGTTTATGGTTGCATCGGTTCTATATCATTTTCATGGAATGATATTTTTGAATTGACTAAAATATATATAAT
ATAAAATTCTGACCAGTAATCATGAGAGACCGACACAAGCCTCCCTAATCAGTAAAACGGGTGCTAGATTTGGGATACAGAGCTCAACACAGCATTCCAA
ATTATCTAGAAACATGTGCTATTTGAGGTAGTTGCAATGGCAAAAATATAGATAAAAATAAAAGAGACCAATGGGTCATTGGTCCGGTTCAGATCTTGAC
CCAGGACTCAGACCAGGAGGGTCAAGCCTTGGGTCGGCCCAATAAAACCACTCCGAATCGGAGCCGTTATGTACACAACCTCTAAAACCTTCATCTACTC
GATAACATTGCTCACAGTAGCCTGATTTAAATATTCAGTCCAACGAAATTAATATTTGAGTTTTTACTTTCAATTCCCGCGACCTACCTATCTCAGGGTA
CCCGATCTACCTTAAACATCAGTGTGCCATTCGTCCTAAAGCATATTGCAGCATCTTGACTCCAAATCAGTCCATTATAAGCTATTTTCTCGTCAAACGA
CA