Description :
From Genome Similarity Track
Location :
Scaffold_7:241711- 242933
Sequence
1222 bases(100 bases per row)
TCAGTTTCAGCACTACGTCAAGAACGAAGCCAGCCAAATCTTTGACTGATCGACGTCCGTATTCCTCTTTCTGTACAAAGCTACGACGATCGAGTTCTTT
CCTGAGGAAACGAGCACTCGTTCAGGGCTACGGGACAACAAGCAAGTAATGGACACGATCACAAGGGGAAATGGAAGCGTTCCTACCCGAGGTTTTTACT
AACAGATGCCGTGATGGTGTGGCACTCAAAGATAACCACATACAAATAATATTTGAGGAGTTCAAAGCAAAGTCATAAATGACGTCGACTGTGTGAGCTA
CAGTTCTACGATGCGGATCAAGAAGAGCTGAGGTCGGGGCATCAACAAGAGCTTCTGCATTGGACATCGTCGCCGATAACGTGCAGCTCTTATGCTTCTG
GTGCAATCGTGATGATATTAAAACCAGCTTATCTGCTACTGCTACCACGTGCAAGCGCTGGAATGGAGAACGGTAGAGGTACGGAACCGAGGCGCCACTC
ATCGACGCAGTAGCACAAGCAGCAATGCTCGGCGAAAAAAGCGAAAAACGCGCAAGTGCTATAACAGCTTATAGCAGTTAGGCTCGATAAATTCGCTGCA
TGATTCAGTATAGGATACATCTGCATTGTGCGGTAGATTGTACATAAAACTGAGTATGAAAAAAAGAGGTAGGCGTCGTCAACATTATTAAAATGCTGGG
ATGGCCAAAATTTACAGGCGGATACTGCGTTCAGGGTCACACTTAAAGAATAGAGTTCCAGCTTTATAGTTTGGGGTTGGACAACATGACGTCGTGCCTT
CAGATAACGAATACAGACGGCGTTGATCGTCCGAAGTGGACACATGTCGCATCAAGATGGTGGCAATTCGGAGGGCGTCGGTGAGAGTCCCTGGATGGCT
AAAGGGAACATTTACAGACACTTCGGGCTTAATAAGTGAGGCTTGACTCCCTCGCGACGTTCATAAACTATCGGACGAGGTGACTGTTGTGCACTTGTGG
AATAGAAGCTTCTGGTTCAAGTGACATGTACAGTTCCCTGAGTGACGACAAAAAAGTAAACCACAAGACCAGCACGTCATACGTCGGTTGGTATGTATAA
ACACTGGAGGAGACGGTCACAAAGTGGCAAAAACGGTGTAATGCCGCGTCATGCCCAACACTTTCCATAATCAGTTCCAGATCAAGAAATCCAAAGTGTT
AAGATAACAGCTTGAATGAGTG