Description :
From Genome Similarity Track
Location :
Scaffold_1625:2417- 4179
Sequence
1762 bases(100 bases per row)
GATTAAACTACCTGAATCCTCTGTGCGCTCAACGTTTGAGCCAAGATGGACCGAAGCAAGTTTCTTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGA
AGATGGGAGGCATCTTTGGACAAGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGTCGAGCAACAAGAACGCGTAACTGCGTTTGAGACCTACGAGCG
TGGTCTCATCGCTCACGTCCGCGGGGGTTTGGAGGCCTCGATGGCCACTCCCCAGGTAACCATGTAATGGGCCCCTCCATTGCATAAGTAGGTAGATTTC
TTTACAAAAGTAGGTGCATCAGCACACGACTAGCGTGTGCTGAAATGCTGTCATGCCATTGGCTGATATATGGGGAGCCAGACCCATTATTAGCCAATTG
GACTATGACGTGTATTTGAGTGCCAGGGCTGTGGCCTTGTCTAAATAAAGTCAGAGTTGATTTTCCTTAAACTAAGACTCAGTCGTCCTATTGCGAGCTT
CCTCAACACTATAGTGTAAGCAGGTATGGAGTAAATACCTGGCCCGTTACACAGGCAGTATTCGTGTAGTCGTCTGACGCCGAGAGACGAGTTTCTTCCG
ACGTTTAAATCGCGCCAACCCAACCAGTAGACGCATCAAAGCCCGATGCCTGAGGACCATGTAGCTCTTGGTAGATGTTCAGAGCTTGCAGCCGGATGTA
AGCGTCCTTGACCCGCAGTCCTCTAGTATTTCTGTCTAAAATCCACTCATGTAGACGACATTCTACATCACCGTGCTTGGCAGGTCTTCCTCCCCCACCT
AGCCTTCTTGCTGTACGCGTGGTAATATCACGGTCTCTCAGAGCTTCCTTTAGTTTGTCGCGGAGATCCCACCAACCTCGAATTGTTCCTGGAGCTATTT
GGTGTTTTTTTTCCCTAGAGCAAAGAAGCCTTTTCCTTTGACGCCTTTGGCGTGTTGGGACAGGATATCCAGCTTCTCTTTGATAGTATAGTTTCGGCGC
TTGCTTTTCACCATGGCAACTTGGGAATGAGCAACCGACAAGAGGAACGAGAAAAGTTGTGGTCAAACACTGACAGCCAACCACCTCCTATTACAGTTAT
AATTACACATGTTACTGTTGTATGCAGTAGGCGTTGTATTTTGCTATGTGTTCTATACGAATATTTTATCGCGAAAGATAAAATCCATTATTTTATTAAA
GCGCCTAGGCGTAGGTGTCTGTCTGTCAGTCCGTCCGTGGCTAGGGTTAATAAAACTCACGCTAATGCGGGTGTTCTACTGGCTGCCGAGCGCAGCGAAG
GCGACCCCCATTGGCTAAAAGCGACATTGTGTTTTGTACACACTTTATGTGGACTACACATCGTACTTAAAAGCACTACTTAAATTTCATTTTGCTCTCA
TTTTCAGCTGCGGTCTGCAAGGCTACGCAAAGGGCGCTGCCTGTGTGCGCGTTAGTGAGCATTAGGATAAAATGTCGATGATCACACACGTACGTTATCG
TCTTAGGAGCTGTTGAAAAAGAATTGTAGGCTTTGGTGACTCATATTTCGAAACTTTAGTACTTTTTGGTAATAAAATGATATTTTAGGCTTCGTAGTAC
TTTTGTAACAAGTAATCTTTTAAAAATGTTTTGCGCAGTACTATTCAAAATATTTTTATATTATTGCATTGCATTTATTTGTAGTAGTAGTACACAAAAT
TATCATATAAGCTTAAGAAAAGCACAGCTTTACTACTATTATTAATGTGTAAGCTTTAAAAT