Description :
From Genome Similarity Track
Location :
Scaffold_62:241662- 243149
Transcript NameFunction/comments
Phyci_313563Hypothetical protein

Sequence
1487 bases(100 bases per row)
GTCGAGCACGCCTTCCAGGTCGACGTCCGTCTTGCCGGCGCGGAGCTGCTTGATGATGGCCTTGAGGCGGTTCACCTGCTCGCTCTCCGAGTTTTTGTTG
GCGTTGTTGGTGATGAGCTTGACGCGCGACGCGTACGTGAGCGACGTCACGGTCTCTTCCTGGACGAGACAAGCAGAAGAGCCGTGAGTATATCGGCGAC
GACATCATCTTGCCCTTGTCGCGTCGGGGTGTAGCCATTCAAGACAAAGCCAAGACGAGCAGCCGTACCTGGTTGTAGTCGGCCGGCGAGATGTTGACGA
ACATGAGCTGCAGCAGCAGGACGACGGTGCTTAGCTCTCAATACACAAAGATTGACGTGAAGAAGAAGTGGTAAGACCCACCGTTTTGGCGTTGCCACCG
AGCGAGTCCTGCATCAACTGAGTCAACTGTCATCACATACACCAGTGAATTGTGAGAGACCATTGAGATCACGACACGGTGAGTGGAGGTTGATACCTTG
TTATTGCGGTACGGAATGAACTTTTCGTTTGTCGACAAAGCTGAGATGACGTCTCCCAGAGCTGCGAAGCAAGAAACGTCACGATATTTACACAAGGACG
ACACGTAAGCGGTTCAAATGAGGCCCAACGCAGCAATTTTGCTTGCCAAACTTACCGCTGAGACTCTTGTTGATGGCCTGAGCCTCCTTGAGTCGCTCAG
CTGTGGCACCCGTTTTGCCGGCACGCTCCGATCCAGCGAGATCGACAAGGCTGAGTTTGCCGATTGTCGTGGCCTTGGTGGTTTTGTTGTAGCTCTCGAC
GAGCAGCGAGAAAATGGAGTGACTGCGGCTACTTTCGGCGTTCATCTTGGTGGCTCCAACCTGCCGCTTCTTGTTGGCGCCCTCGAACAGTCTCAAGGTT
TGCTCAGGCGAAGTGCACTTCTTGAGAGTGGCATTCTGGACGACGACCATGCCTTTTTCATTCTTCTTGATCTCAAGTTTGTTATCGTGAGCTCCTCCAC
CCTCCATGAGATGAAACAAGTCGATGAGCGTGTCATTGTAGAGCTCCAGCATCGTGGCTTGGAAGCTCACTGTGAAGTTGGCCTTCCCCTCTTCAGCCAA
CGCAAAGAGGTGGTGAATTGCTCGAGGACTGAGCCCCGGGTCGCCCTCACTACCAGTCATTGTAAATGTTTTGCCAGATCCGGTTTGACCGTACGCGAAA
ATGCAGACGTTGTAGCCGTCTACAGCACTTTGAAGGAGATTTTTAGTGTCCTCAAATACCTGGACCTGCGAACTCGCGGGTGAGAAGACCTGGTCGTACG
CGAAAGTTTTGGCAGCTCGATTGCCTCCGCTCACCTCGAGCGAGAACTCGTCGATGAACTTGACGCAGGGAGCGCAACCTCGTTCATTCTCCGAGCCACT
CATGGGGCGACATCGAGCGTACACGCGGATCTTGCCTTTCATGTCTTCGATTTGGTTGTAGTACTTCTTCCGCAGTGCCTGCTCTTC