Description :
From Genome Similarity Track
Location :
Scaffold_187:24162- 26114
Transcript NameFunction/comments
Phyag_g3246conserved hypothetical protein

Sequence
1952 bases(100 bases per row)
ACCAGGAAGGATACCGGCACACAGATACACACTGGGCGCGAGAAGCAAGTAATCCAAGCTGACAAACGTATCCACACCACTCAACCACTGTTGGGTTTGG
TTGACGTGAATTGTATCCTCGCAAATTTCCGGTATGCCCTCAGCACGAGCAAAACGGTCGGTTTGACGGATGAACATGCAGAGTGTGGACCACACAACTC
CATCTGGCGTGACATCATTTCCAGTTTGGCACGCTCTAACCTGACCATCCCGAAATGCCAAGTGCACCCACGGCATATGGCAGGACGTGAAATACGCAGC
GCCATCCTCAGAAGCGCCTATGACATGCGAGAAGTATTCAGAACGCGAGAGCGcgtgaaacagggcgagacgcgctctgtttctttagcatacactagta
tgcgcttNtgccgtatacttgtccatgtatagtccggctatacacgtatatctggtgtacccagttacaccagcctgtgtaaccctgttacagcGCGTAT
ACCACAAAAGCCATTGGCCCTCCAGAAGCTTTGTACTCATCGACCAGCTCAAGGAACTCGCCGAAgccgtcttcttccagaAGCCAACGAGGCTGTCAGG
AGCCAGCAGTCTTACCTGCCGCAACTATGTACTCCACGAAGTACCGTGAATTTCGTGTTACCTGCGTACCGATCCTATCGGAGATAGTCCAAACGTACTA
GCGGGCAGTCGTCGCATCGCCACGAGGATCACTCTCCCGCTCGGCTACATGAACAAGTGATCTCCAGTTGAATGAGATGCAGACGCCTTCGTGTTATCAT
CATCTGGCTCTCGAGGGAGCGAGTGGTCGCGCAGGGTAGAAGTACAAGAAGCAAGAATACTCGACGTACTCAATGGGAGGCGACGGAGCGCTGGCGAGCA
GACGGAGGCGAATTGCAGGCTGACAAAAGTACAGTAGTAGCTATTTGCAGCATAATGTAGAGGAGGGGTCAGAGCTGCATGTACTAAAGTAGGACAACAC
CCGCGATTGGTGCAATGTGCTCTCAACTGATACCCATGTTTTCCCCCAGAGTCGACCGTTCCGTGGATACAACGCCAAAACTTGCAAAACCACGGCCAGT
TTGTAACACGTTGGTCAAAAGTAAGAGGTCGCACCTCACCGTTGGTATTAGCCCTACTGGATCGgattaaaaaaaaatggtGGATGACATGATCCCAGAA
ATCGCAATGCCTGTGCGTCTAACTGACGAGCACCAGAAAAAGTTCAATCAAAAGTACCATGCTGTCGAAAATTCCACAGTTTTAGGCCGGTTCCTAACGG
GATCACCCTCAGATCATGATCCGGTTTAAGGAGATCTGATTGGTAATTAAAAATACAGATGGTGTCCCAGCCGCCCTTTGCTAAATCCCATTGCGAGATC
ATCAGCCACTTTCGGATCACCGATCATAGCCACTTGCTATTACTGCGCCACTCGGGTCAcgtcgttgaagacgaagatctCTCGCATTatcgtgtgtgtg
tgcgcAGCGGTAATGGTGAGCGAATTCCGGTGTCATCGGAGATCTGGGGTTGTAGCGCGGAAACGCTTGGAGTGGGAGCCCCACCATGATCGATTATTGA
AAGAGGGCCATTTTGAGCGTTACTATAGAATGGGAATAGATGATTTCGAAGAACGTGTGGATTCTATCAGGCCAGAGATTGAGCGCGACGCTGTAAAGTC
GATGAACAGGACTGGGATGGGGCCTATAATGCCAGAAAACAAAGTGCAGTTGACTATATCGTGGTTGGCCGGTGGTTCATTTCATTTGATTAGAGCACTC
GCTGGTGTGAGTACAGCGGAGTTCTACGCTACAGTCGTGGAGGTCATGAAGGCGATATGCTCTCACCCGCGCTATAGAATTGTTCCTCCTGTACATGACA
TCGACTCGATCAAGTTTGCCGCAGCTCAGTTCGCAGAGATCATTAAAAATAA