Description :
From Genome Similarity Track
Location :
Scaffold_66:241619- 249585
Transcript NameFunction/comments
Phyra_82010predicted protein
Phyra_82011Hypothetical protein
Phyra_82012predicted protein

Sequence
7966 bases(100 bases per row)
TTCCTATCACGCAACTAGCTCGTCGCTGCTCTGCTGCAGGTAGCACTTCAACTACCCACTGAGTAGTTGAGCAGCGACGGATCGATCTTCTGGCCCTTGG
TGCGGCGCTTGCCCCGCTTGTTGGAGGAACCAGTCTCAGACGCGCGCTGCTGGGCGTCCTGGTGCCCTGGCGACTTCTTGCCGCTGTGCTGCGTTTTCTT
GCGCTGGATAAACTCAGTCGCAAACGCCGACACGCGCGGTGTTGAGCCCAAATATGCCGCGAGATACTCGCGGATCTCGCCGGGATCCTCGACTGACGCA
CAGTATTCCAACAGCGTCACGTTCGCGTTACTATCAATGGTCGTCAGCTGCTTCATGGCCCACATCATAAACTCCGACGACACGTTGTTTGAACCAAACG
CATTTGACGTGCCCACTTGCACGCTACCAGACGCTCCTGCCGACTCTTTATCAGCCGGCTGAGCAACCCCGAAGTTCCAGAACGATGCATCGCTTTCAGC
CTTCGGCGGCGATGGTCTAGCAGCACCGTTCACAGCACGAACCTGCTGGCGGCTCTTCAGCACAGACGCAGGCACAGGGCCTAATACTGACCGCGACGGC
TTGGGGATTGCTGCTGCAGCAACCTTGTTACCCGCCACAATGTTCATCCAGTGCGAGCTGGTCGGCACATTCTCGTTAGCCTTAGCCCGTTCCTGCGCCA
GACGTTCTTCTTCTGCCAGAATGTCACGCATCGACTTTGAGTTGGAGCGTTTAGGCACAACGGCAGGGGCACCCCACGGACTTGCTGCAGGTGCAGCAGG
CGCCGGAGTTGGGGCTGACGGTGATTTAGCTGCTGGGGCCGGGGCCGAAGGACTGCTTGGTGCCACAGCCATCGAGTCCACGCCCAGCATCATCTTCAAT
TGTGCTCCCATCTGCGCAAGATTCGAGGAGCCGGACTGCTCGTCGTCCATCTTGCTGAGCATTTCGCGCTGCTCTTCCTGCTGGATATCCTTCAGCGACT
TCGATGCATTAGAGGCAGTAGTGGATGCCGTCTTGGTGGCCCACGCATTTGTCTCACTCTTAGCGTTTTCTCCTTTCTTTCCGTTCTTTTTAGGCGGGCT
AGTGGTTGCCATCTTCTCGCCTTCCCTGTCAGTCTCGTCATCCTTTGCACTTGTCTTCACAGGTGATGCAGCCTTGCGCTGTTCTTGCTGTGTGCCAGCT
TGCTCACCATTTCCGCCAAACGACTCGCGAACTTCATTAACAGCACGGCGCTTTTCATCATTCTGAATGTCATGAAGCGTTGGCGTTGGGTGCTCAGGAG
AAGTCGGGCGACCACCCCAAGCATCGACCACAGGGACCGCAGCTGGACTTTTTGGCGCGGGAGGTTGAGTGGGTTCTAGTGCCATCGGACTGGCTGGTCG
CGCACCCAGCGCGCTGGTGGCGTTGTCCAAGCTAGACAATTCCGGTGCGGCATTTGGCCAAAACGCCTGGTCGCGCCTCTGCACTTCGTTATTCAAGAAC
ATCGCATCTTGACCGAGAGGCTGCGGGTTCTGCATGTTAAGCTGATGCTGTGTACGATAGTCGGATTGAAACTGAATCTGCATACCGTCTGACCGGAAGC
TGTCGTTTGCCGAGTTATTGTTGCTCTGGTTTCCTCCAAATATGCCAAGCGCACTCATAATGCCTTCACGCTGGCTGCGTTGCCACGAACTTTGCTGCTG
CAGAAGCATTTGCTGTTGCTGTTGTTGTTGCTGCTGCTGCTGCTGCTGCAGTTGCTGCTCTTGTTGATGTTGAAGCATCTGTTGCTGCTGATACAACTGG
TTTTGCTGTTGTTGACGTGCTATCTCAAGGCGCTGCATTTCCATGCGGATCTTCTCTTCTTGGAGCATTCGCTGCTGTTGCTGCTGCTGTAACTGCATCA
TCTGCTCCTGTTGCTGTTGTTGTTGTTGACGCTGCAGCTCCAACAGACGTTGCTGCTCATTCTGGCGAAGGTCAACGTGCATACCTCCAACTCCGCCCAC
ACGCGTTGGCGGGGAAGCGAAAGGCACCTCTCCGTGGACAAACTGATTCGCGAGGGCCCCAAAAGTGCCTTCTCGCCCGAAACGGATTGGAAGGTGCGGC
TTGAAGTAACCCGCCTCGAACCACTCGCGCATGTCCGCTGTTTTGAACGGTCCCTGCTGCAATCCCTGAGGATCCAAGTAAAACCACTCGTCTTCCACTT
CCAGACGCAACGACGAAAGGCCCGGGAATCCCTCCTGGGGCTGCAGTGGTGAAAGCGAAAAACTACTCTTCTCCTCTAACGCGAGCTGCTCGCGAGCAGG
TTCCAGCGCATCGAACAAGTGTCCACCACTTGACTGGCGACCCAACAAATCTGCCGTGTGATCTTCCACTGGACCATTGGCACCGTTCGCGCTGTGTTGC
TCCTCGGGAGCAGAGTCCTCCCACTGCACGTCTTCATTATCACTGTCATCAAATTGCCCAGCAGCCGCAGCGTCCTCCAGTTTCTGGTCAAAAGCATCCA
AATCATCTTTGATCTCGTCCTGCCAAGCAGTACACCGTCAGTTCTTCGCTCATACGCACCTAATTCGTCGGGGCTTGGGCTTACCGGGTCGACCTTCGGT
CCCTGGAGCTCCTCTCGCATCGCATTCATCTCTCGTCGGAACTTCTCTGCGGCTTCAGCCATACTAGACAGGTCCTGTACCACAAAACACAACAAACAGC
AGAGTAAGCCATCCCCAGCTCCTTCAATATCACAATACAGGGACGCACCATTTCATTGTTATCCGTTCCAGGCTCCAGCACGTCGTCCCACACATCGTCT
CCAGCGCGAGAACTCTCAGTGACCCTAGCGCCGCGCTCCCACGTTGAGTCTCGCTCATTGTGTCGGTGGTCGTCCCTCTGCTGCTTGGGGGCCTCGTTCT
CCTCTCCACGAGCTCCGCGTTCCTGGTGTCCGCGCGCGTTCTGGGCTCCTCCAGCGGACGCGTTACCGCGTCCACGTCCCCGACCGCGGTTACGATTAAG
CGACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAACGTGCTCACGGGCGGCAGACTGTGCTCGGACGCCACCGACGTGTCCGGTGGGAACGCGGGC
GCCTCCGACGTTGTGAAATGCAGCGCCAGCAGCTCCTCCTTGGAGTAGCGCAGCACTTTGTTCTTGCGTCGGTGCTCGTCTGCTGCTCCTGCGGCTGCGT
CTTTAAAGGACGCGGGTCCGCCTGACGCCGAGGACGATACGAAACCCTCGCCGTCCTTGGACCACTGCGGACGGTAGGCGGATCCCTCGGACTCGGTGCG
GCCGCGGCCCTTCATGGCGAACATTGTGCGCGGTCGCAGCGAAATGTTGCTGCTGCTGTTGCTGGCTCCGTCTGCGCTGGTGCCCGTGGGGGGCTTCTTA
GCCGCGTCCTGCTGCTGTTTCTTGCGGTGCTTGGTGGTCTTGGTGACGAAGTCGTCGTCATGGCTGGGGCTGCTGCTGCTCATGGCTGCGGCCGGTGCGC
GCTTGGCTCTCGGTTGTTGGTCGCTCCTCTTTCTTTTTGTGTGGGGGGAGCTGCGCGAGGCGGTGCTAGTTCGGCTAAGTACGAATAAAGATTTGAGTGT
GCGTCACAATTTACAATTTTCGTACTGTGCCATGAGCGGCGCTGGGCTGCGCAATTGGCGGTGCGTTCTCTGCGTGTGTAGGAAATGTTAGAACTGTTTG
TGAGTGGCACGTGCGATTTTAATGCTGTGTGGACTTCTGGTTGAACGCTCGGCGTCTGATTCCATTGCAGCGGCGAGATCGTCGAGGCTAAAGCTACTCC
GAGTGCTGGCGACAGAGATAAGGGCGGCTATGAAGCAGATGCGGTCGGTTCTCGGTCTGCAGCACCAGTCACGCCATTACCGCTGAACGCTCGAGATCTA
GCGTCGGAAGAGCGACGTCCCTCGCAGCAGAAGGTGCTGCGAAAAGACGAGTTCGGTCGTGACGTGGAGGTCGTGGTCGACGAGAAGCGTCGCAAGAAGT
CCGAGGGTGAGCGGATGGAGGACAGAAAGAAGGAAAAGAAACACAAGCATAAGCACAAGAGCCGCAAGCATTGCCGCAGTAGGAGATCGAAATCGCCGAG
TGCGCAGGGTCAATTTGTTGGGACACCACCGCCGCCAGATCCGTTCCGTCCTCAGGTACGTGCTGCACCTGTGACTGTGCTGGTGCTGATCAACTGGAAT
GACTAATTGGCATTGATGCGGCGTCTTATTAGCTTGATGAAACACGATATGGACGCTCGCAGCGACACCAGCGAGAGAGGAGTCTTGGTCGAAGTCGCAG
CCGTAGCCGGCACCACGCACACCGCCGCACTCGAAGCCGAAGTCGAAGTCCCCACGCCAGAAACCACAGTCGCCACCGCCGCCGAAGCTCTTCGCGAAGT
CGTAGCAGAAGCCGAGCCCGAAGTCGAAGCCCACCCTCTCGGTCTCGTCGCCGGCGCTCGTCGGCCTCCGTGGAGCGCAGGTGGACACATAACGCCTTCG
ACGGTCGCAGCCCAAGCCCACCACGACAAGTTGATCCACTCTATCGTCCTGATCCTGAGGCCTGGGTATCACGTGCAGGGGGTATCTACTTGCCTCGCAA
ATAGCTTCATCTCTCGGAAGCGTCGTTCCAGTTTTCGCGTCGACTGAAGGCAGTAAATGAGTACGCTCCTCCGGGACTGGGATGAAGGTGTGCAAGCTTG
ATGTTTAGCTCTTGTGGAATGATACGCATTGCTTCGAGTTGCCTGGTTCGACGACCATTGACTTCGCCGTCCTCCCTGTTCCTCTTTCAGGCTCAAAGAG
CAAGCGCAAAAAGCTTCTTGAATGGTTTTGCAGTCGTTTTGACCAGACACAAGACGGTGGCGGTTTGCTTGAGAGTGAGTGTGGCGCAGATATTGCTCTC
TTCTTGCCGCGCCTCTTATCATGGATGCAGAAAACGACCGTGACTGCAATTGAAAGGACTAACGATAGCTGCGGTGCCGCGACAAAGCCAGAAAAAGTGA
AATGTTTTGCCCTCGGTGAGCAAGTGGCTTGCCTGAATATATTTTTCGGGGCTGCAAATGCGCATGCATATTATCGTGAATTTCAGCACGCGGATGGTCT
TCAATTGGTGCTAAAAATCGCGGCCTTGCAAGGCAATGATCCCCAAACGCAGAAACCACTTGTGCCAACCACCAACCGAGAAACCTTATTTCGCATCATC
CTACGGATCTCTAAGATGAGTCGACAGTGCAAAGAGGAAATCAGTTCTCTTGATGGCGAGTTAGCTGTGATTCATGGGATTTTAGCCAGCGGTGACATTG
ATGATTGGAAAGTTGAGTCTCGTGTGTGGACTCTTTGTCGAGAGGTTCTGCTTGAACAGCTCGTAGGCAACCCCAACAGTCTTGACCGAGCCCACGAGGC
GATTGTGTTTATGCTGAATCACTCAGAAGTGCGCCTTCAGCTCTTTGGGGCACAGGTACATAGGCTTAGTGTCGCTTGCTCCTGCATCAATTGGGGCTCA
GTATGTTGGGTATCGTTTCTTTATGGCACGTCGGTGCTAGGTTCTCCGAGAGTTGATCACAGAAGGATCATTTTCGTATGATCCAGAGTATCGTCGCCGA
AAGGAGTACGATCTTGTGCCTCTGAGCCTGATCCTCTTCAATTCGACTGACGTATATCTTCAACATGAGAGCCTCGAGCTTCTTCACGCTCTTCTACAGT
CGAAGCACTTGCAGGTTGAACGTTTATAATCCGCAACGTCTTCTTGAGGAAATTAACGCGTTTGAGTGGCTGTAAAAGGATCTCATTTGCGAGAAGCTCG
TTTGCTTGGTTGGCGACAGCGCCAAGACCCTTGATGTGTATGATTTTGCCTCCGTTCTGCTTATTATTTGAGGCCCCACTTACGAGTTTTATACTGGTGC
TCTGATTCCAGCAAAGTTGAAGAGCGCTTCGTCTCGATCGAAGACACTACAGAGTACGAAACCTATGCTCATCTCCGTTCATATTTTGCCCGTGTATCCC
AAGCCGTCAACACTTTGATGCACTCAAACCGGAACTTGCTGCCGATTTTGGTACGTTCATACTTCGAAGTACCGGTCCTTTTGTAAGCTAATTGCATGTG
CAGGTTGATCGGCACGGTCTACTCACACCTCTGGCATTCTTGCTCGTTGTTGAGCGACCTCACTCACTGAAGTGGCATGCTGCTGCCATAAGCATTCGAT
ACATCTTTTCTCACCATTACCAGGTAATGAATGAGCAGCTTTACTGACAGGCATTTGCGCTCGCTTGTATTGACCACTTGAGATGCCGTTCATGATGATG
TTAGGCAGCAGCTGTGTGCCTCGCCGAGCTCTTCGAGGTCCCAATGGCTGAGCTGCTCGTGTGGAAGAAGGATATACGTGGCGATGATGGCGAACAGCTC
GCCGAATTCCTCTTGGGCGACGATGCTCATCAAAGCCATCTTGCGCTCTGGTTTTATCAGCGTGGATGGTACCGCCCGCTATCTCCGAGAAAGCAGTCCG
AACAGACCGGAGCTGATCGTGCCCTCAACGACGTCGAGCACAGTGTTGAAACAGCGGCTCGAGACTACGTTCCAGAGGTAGTATCTTGCAACAACAGCAT
TCTTTAATCCGTTCCGCTCACTCCCTTCGTGTTGATACAGCTGCAAGTGCAAACGCGAGTGGGTGAAAACGCTGACGACGCCGAGGAAATGGACATCCTA
GAGGCCCAACGCGAGCACCACCTGCGTATCCAGCTACAAAAGCATTTCGCCCAATTCCGACACGTATCAGCAGCGACTGCAAGTAGCGACAGTTGCAAGT
AGACACACAAGCTAGCAATCGACGTGAAATTAATACTACTGGGGCCTCCGACCCTTTCCGCCAAGGTCTTCTTAGCTCTCCTCGGGCGTGTAGTGGTCCT
CCAGGAAGCGTGAGAGCGTCTGCAGCTGCTCTGACACGACCTTGACCTTCTCGCGGCTGATCTCAACGTCCTTCTCGGCGCCGTACGTGCTGCGCGCGAA
GGTGCGGTAGTCCGAGACGAGGTGGATGTGGTTGGCCAGCTCTGTGTGGATCTCCTTCACGAGCTGCAGGAACTCGGTGCACGCCGAGTTGAAGGCCAGC
GACGAGCTCTCCTCGGACGACACGCGTGGCGCCATGAGCGACATGGCGGTGGCAGCCGTGCGCAGCGCTGTCACCAATTTCTGAGCGGCAGAAGCAGTAC
AAGGTCAGTCGGGATTTTACGCGCAAAAAGCAGCAAGTGAAGACGGACTTTTCAGGCAGCAGCCTCACCTTTTCGACGGAGTCGAGTGCCTGTAGTACCT
CGACATGCCGCGAGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACGCGACTGTCGCCCTCGCCCTCCATGCTTGTGCTGTGGGGAGTGCGAGCAAT
CCCCTCGAATGCGTTTTATCCGTTTGGACAGGCTATACCCGTTATACCCGATAGTCTCCATGTATCGATTTCAAGAGTGGAGATCGACTAAAGCGAGCCG
CCTCTACAGAGTCCGTATAGGCTATCCGGATATTGCTGCCGTATGCTTGCAGCGTTGACTCACGAGGGACTCGGCCGCCATCCGCTCCGCTGGCGCCTTC
CGGTGCAATTTAGCGCAGGTACTGTAGATCAGTGACCTTCGCACGTTGGGGGTGGTTTGGTGGAGCCTCGCAGCTGATTGCCATCTTGCTTCAAGCTCGT
GCTCTTGAGGATAACGCCACGTCCAGATGCTACTATCTCCAGGCTCTCGATGCACGAACGTCGACTAACCTTATCATTGCGATGCGCTTGTGGTGGAGAG
AGGCGGAAGAGTGCGTTGCAATCGTCCGCCGCGCGCTACTTGTCCGGTTGCGAGCCTCGTGCTGCTTGTGGTGGTGCGGCGGCGCGACGACTTCGTTTAG
GTGACCCGCTGCTAGCAGCCTGCTAGCTCTCTGCTTTTCGATGCGTCGTTTCGGCGTCGTTTCGTG