Description :
From Genome Similarity Track
Location :
Scaffold_1207:2416- 5662
Transcript NameFunction/comments
Phyag_g9892hypothetical protein
Phyag_g9893hypothetical protein PHYSODRAFT_413604
Phyag_g9894hypothetical protein PHYSODRAFT_523131

Sequence
3246 bases(100 bases per row)
TGCTGAGGCTTGTGTGTCAAGTTCGTGGACTGCGTCGCTTCATGGTCGAAAACGTATCTTTTGGTGGTCGTGAACTGATGTAAAATACACGAAATAATCC
TGGCCAATCAAACATTTTAGTTTTATTATTCTTTTATATTGATATTTAATCGACTACCTAAAAATGATCGAGGACTCGgagttggaggtggtgtTAGCCT
TCCTGAACTCTGAATTCGATAAGGACTCACTAATATTGGATACCGACTACGAATTGGAGGACAGCGTCAGGCAAGAAAGGGGCTCTTTGCCTCTCAATGC
AAGGGTCCCACGACCAAGAAAGCCAAGAGAAAAGACAATCAAACACAATAGAGCTCGCGACGAGCGCGTGGTCGAGCTGCAACGTCTGAGGCACGAGGTG
GAAGATCTGGAATTTACCttggagcgactgcagacTATCCGAAGGAGGGATGGGTCGGGTTCGGAACAAAACGACGATTTTGATAACAAGAGTGGAGAAT
CAGTTTGGAGAAATGTGTGTGCTCGTCAACTAGAACGACGTCTGAGAGTTGAACGGGAAAATATGCACCTGGTGAAGAATCTCGAAAAGGACAAGCAATT
TATGAAGAGGTTAGAGAATCTGCTGAGTATGCGACCGGCGTTGTGGAATATGGTGTGTCCTGAACCACGCAAGTGCTTGAGACGCATTGATATTCCTCCC
GGAAGCGTGAAGAACATGGCTGACCTCATTTTTCAGGAGCTTTCAGTtggcgtcgagctgctttATCAGAGTGTGGAGAATCTGGATGAGGTTATTAGTC
CTCTACTGACGAACTTGTCGTCACGCGAACCACTCCTGCGTGGAGGCAATAGTGGCAGACGCGCAGAGGCCTTTAGTTGCACTGTTGTCCCGTTCGGTAT
GACCGAAACTGGAGATGCCTGGTGGCGATATTGGAATGACCAGAGGGGTCAAGTCGTGCAGGACAGCACTGGAAACGTGGTGACAGAGAGTTTTGGGTAT
GAGATTATCGATGTTTCGACTAACACTTCGGCCACATTTTACGTGCAGCAAGTGTTACGACGACATGTGGAGAACCATCGTATCGTATTCGTTTGGACTG
GGTATTTCGAACCTTTTGTTTTTAAAGGTAAACGAATGAGAGGTGTCTATTACCGGGAGCAAAGCTACGTGCTTATCAAACCTGGGAATATTGAGGGTGG
GATCACTACAAGTGTGTCGTCTTGCGAATTTGTATCGCACTATTTCTTGGAGCCAACGCTGAGGAAAGATGCTACGGTGACAGCTCTGACGAAATTGGTA
ATGAGCTCCATGTCGTCCGATATCCTCACGTGGAACGAAACGATCgagagtttgctgctggatcaagCTATGCAGAAGTGAAATTCATCTGTTGAAGTTT
TTGGCTACTACGACTGTAGACTGCCTCACTCGTGCGACGCCTGGTGTATTATATTTTACGCCCGGACAGTGTTATAGTTGAAGTCGCGGAGCTCACATCC
GATTGCAAGGTGCGAAGAGAATCGAAATTGAAGGAATCGCTCGAATGGAGTTAAATGATACGCATCACGGTAACTTCGATGATAGCAGTACACACGCCAG
TTCCTCATTTGATGCTGAATAGCCTTCTGTTTCCACCACCAGTGGTGATTTTTTATATACCATATTGTAGATCTAACAACAGCGAACGATTTCCATGGGC
GCTGAAGTTACCTTAGTTCAGTTGCTCTTTAGACGTTTATGCTCTTAACAGTTGCGCATGTTAAGAGGACATATCGCCATAATTTTCATTCGCGAACAAA
TGAACGCTACTTCTGGCATCCGCCTCGCCGGCGGCTGCCGTCTCTTGGGCGTCGCACTGGTCGTAGACGACATCAGCAAAGGATGCAACTTAGCATTCCG
ATATCCTGCGCCCCCGTCCGAGAGTGCATCCAGTTTCCACACGCTGCCCGCGCCCCTATTGGCCAAGCTCTTCCGACCCAAGAACGCGTTGTGTAACGCC
AGTTTCGAGCTTGTAGTAGACGATCTGCGCTTCGTGAGCCACCCTGTGTTAGTATCCCGTCGTCTaccggctgcagctccagcggaCGGCCCGGGGAATG
GTTCTACGTCGACAAACTGCTCAACATCGGCTGCAGGAGCTCCCCTTACAGTTGTAGAGCAATCTTCAAACGGTTCTACCTCGTCGTCGGGGAACGAGAC
TACCATGTTCAACATCATTTTTGCATTGGAAGACCGTCCTCCTCAAGCATCAAGAGCAACTGAGACTAGGGATGGCACCATGGATACCCAGTTATTACCT
TTGCAacaagcagatgaagaggaacTATTGgccagaagacgcagcagcgctcaAGCGTTCCACACCGTGGCGGCGCAGTTGTCCAATGGACTCTTACATG
AAGAGCTTCGAGTGGGTTTCGTGTCGAAAGAAGTGAGGGAGTTGCTCCAGTTGAGGGATGAATTGGCACAGAGTGAACGCAGTGTCTCGGGGAATAACAG
TACAGGGATCCCGGGGGTTACTAGTGGTAATAGTGTGAGCGtgagtgctgctgttgcagcgggTGCTACGAGTGGGAGCAGTATCACGAGTAatgcagga
ggaggaaatgCGACCAGTGGATCGAGTTTGATGCACCATCATCATCACAGGAAGGACGGGGAGAATGGATCGTCGGCGGTGGATGTGGATCCACAGACGC
TGATCGACGTATCTTTGGGGAAAAGCGTTTTGGCTAATGACCTGAAGCGGGTGTTTCATGGACTGGAGGAATCGGGGGCTGCTCACGTGGTGTTGAATGG
ATGGGTGAAATTATCGCTGACGCTGACAGACGCGGTTACGGTGAGAATGGCCAGTTTACGACCGTATCATACACTTCTGCTACTAGCTGATAAAGAGGAT
ATTCTCAACAAGCTACCTGCAGATCATGCACGGCAACTTCGAGACctagttgaagtggtgaaTCCACTCAAGAGCTTTCAAGATATTGCGCTTGAGACTG
GAGTGCCGATTCATCAAGTTTTTCGACTGTCAGCACATCTTGTGTATTGGGGATTCGGGCGCATTGTCGATGCCATCACACTGTACAACATTTATCAGGT
CAATGCGAAGACAGGTCTGCACATTGCATCGCCACTAGCGCTGGAATTCCGGCGTAAGTTCGCGCCTTATGAACTTGCAGAGGTGCTGTCAACGTTTTCT
GGATCTCGCCGTATTGGGGAGTACATGAAGACCTTGTCTACTGCCA