Description :
From Genome Similarity Track
Location :
Scaffold_160:24159- 26686
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_160-snap-gene-0.25(Fragment)
Pytve_DAOMBR484maker-pve_contig_160-fgenesh-gene-0.4Glucose regulated protein /BiP

Sequence
2527 bases(100 bases per row)
CTCCACACAGTACTGTACACATTCGAATAAAGTACGAAATGACGTTGCGGCAAAAATACGGCAAACCAAGGGTCGCTGCTCGCCACGTTGCCTCCCCCAG
AACATTCCACGTAGTCGTCTCCCGCATCCGCTATCTGTAGGTGGGTCTCGGTCGGCGGCGCTTGCTTTCGCTGCGAGTTCGGTGGGCGGCAACTTGATGG
CGTTCTCGAACGGACGCGGTGGCGGCGCCTTGGGACAACGCGTGGCACACACCAGGCGATCCGCTCTTGAACGTTCTATACCATACATTCTCCAAGTTCT
TTCGGCTCTTCTAGAAACCCAGCCGAACCGCGTTGAAGTCCGTCCACGTAAGCACCTCTTGCGGTCCTGTATTCCGCTGCACCACAGTACTTGATCAATC
TTGACGTTTGTATACACCCCTGTATTGAGTGTACCCACAGTATTCCTCGATCTTTCCTTTTTGGACACGCGTGTGGCCGGTGGGGGGCAAGCAGCAAGCG
GGTCATTCGCGAATTCGCCGAGCGCTCGAGACCCGACGACGGAGCAGACGCGATGAATCTGAGCAAGATCCTGTTCGTGGCGGCGGCCGCGCTCGTGGGC
GTGGTTGCCGGCGAGGAGGCCAAGGGTCCTCGCGGCCCGGTGATCGGCATCGACCTGGGCACGACGTACTCGTGCGTGGGCGTGTACAAGGACCAGAAGG
TGGAGATCATCGCCAACGATCAGGGCAACCGTATCACGCCGTCGTACGTGGCGTGGGACTCGAACGACGAGCGCCTGATCGGCGACGGTGCCAAGAACCA
GGCGACGATCAACCCTGAGAAGACGCTGTTCGATGTCAAGCGCCTGATCGGCCGCAAGTACGCGGACAAGTCGGTGCAGGCCGACAAGAAGCTGCTGCCG
TACCACATTGCGGACAAGCAGGGCAAGCCGTTCATCGAGGTGACGGTGAAGGGCGAGAAGCGCCAGTTCGCTCCCGAGGAGGTCTCGGCCATGGTGCTGA
CCAAGATGAAGCAGATCGCGGAGGGCTACATTGGTCGCGAGGTGTTCGACGCCGTCGTGACGGTGCCGGCCTACTTCAACGACGCGCAGCGTCAGGCGAC
CAAGGACGCCGGCACGATCGCTGGCATGACGGTGCAGCGCATCATCAACGAGCCTACGGCTGCTGCCATTGCCTACGGCATTGACAAGAAGGCTCAGGGC
GAGAAGAACGTGCTGGTGTTCGACCTGGGTGGCGGTACCTTCGATGTGACGCTGCTCGCCATTGACGGCGGTGTGTTCGAGGTGCTGGCCACCAACGGTG
ACACGCATCTCGGTGGTGAGGACTTCGACCAGCGCATCATGCAGTACTTCATCAAGAAGTGGAAGAAGGACAAGTCGGTGGACATTGGTTCGGACAAGCG
CGCACTCCAGAAGCTGCGTCGCGAGGCTGAGCGCGTCAAGCGTGCTCTGTCGACGCAGGCTCAGGCTCGTCTCGAGATTGAGTCGCTGCTGGACGGCGAG
GACTTCACGGAGTCGCTGAGCCGTGCTCGTTTCGAGAAGCTTAACGAGGACCTGTTCAAGAAGACGCTCGGCCCTGTTGAGAAGGTGCTGAAGGACGCTG
GTCTGAAGAAGTCGGAGGTTGACGAGATCGTGCTTGTTGGCGGTTCGACCCGTATCCCGAAGGTGCAGACGCTGATCAAGGACTACTTCAACGGCAAGGA
GCCTTCGCGCGGCGTGAACCCGGACGAGGCTGTTGCGTACGGTGCTGCTGTGCAGGGCGGTATTCTCGGTGGCGCGGACGACGAGCTGACGAAGGACGTG
CTGCTCATCGACGTCGTCCCTCTGTCGCAGGGTATTGAGACGGTCGGTGGTGTCATGACCAAGCTGATCAACCGCAACACTGTGATCCCGACGAAGAAGT
CGCAGACGTTCTCGACGTACCAGGACAACCAGCCTGCTGTGCTGATCCAGGTGTTCGAGGGCGAGCGTGCCATGACGAAGGACAACCGTCTGCTCGGCAA
GTTCGAGCTGACTGGCCTGCCGCCTGCTCCGCGTGGCGTGCCGCAGATCGAGGTTACGTTCGAGATTGACGCGAACGGCATCCTGCAGGTCGGTGCCGAG
GACAAGGGCACGGGCAAGGCCGAGTCGATCACGATCACGGCTGAGAAGGGCCGTCTGTCGCAGGAGGAGATCGACCGCATGGTGCAGGAGGCTGCTGAGT
TCGCCGACGAGGACAAGCTCGTGAAGGAGCGCATCGACGGCCGCAACGCTCTGGAGGGCTACCTGTACAGCCTGAAGAACAACGTCGAGGACAAGCTGGC
GGACAAGATCGACGAGGACGACAAGGACACGGTGCTGACGGCCGTGCAGGACGCGATGGACTGGCTGGAGGACAACCAGGAGGCGAACAAGGAGGACTTT
GACGCCAAGCAGAAGGAGGTGGAGAAGGTGGTGAACCCGATCATGGCCAAGGTGTACCAGGGCGGCGCCTCGCCGGACGACGAGGAGGAGTACGAGGAGG
ACGACGAGGACGACCACGACGAGCTGT