Description :
From Genome Similarity Track
Location :
Scaffold_3:2415851- 2419145
Transcript NameFunction/comments
Phyin_T30-4PITG_02522Putative uncharacterized protein

Sequence
3294 bases(100 bases per row)
ACGTTGGTCCAGGTTTGCGTCACTGAATTGTCCACAATTACATGTCAGTCTTGACCAAATCACTATAACTGTAGTGATAAATACTCACAGAAATTGTAGG
AGAAGAAGTCGTTCAAGCGTCTATCGCCGTCGTATCCGCCAAAAACATAGAACGAGTCCCTGTGGACCACAGCCGAGTGGCTCTTGCGCTGACTGGGAGT
CACTCCATTGCCCAATACCGTGGACCACTCCTTCCTCGCGAAGTTAAACTCGTAAAAGCTGTTGGCGGGACGGATCACGGAGCTGCTGCGGATTGGAGTT
GCAGGAAGGTGTCGCTCTATTATGCAAAAGCAAGGTACGATAAGCAAAGAGATGCACTACACTGGAGACTTGGCAGAAAGACGATGGTCCACCCCACGAG
GGTCGGCTGTACTTCTCACCTCCGAAGACGTAGAGCGAGCCTTTGCGTATGGCACTAGCGTGGCCGGAACCTATTAGTGGGGCTCCCCGCGGGTTCACGC
AGGGCACAGTTTCCCAGACCGGTTGTTCGGAACTTGTCATGTTTGCAAGTGATTTGGCGAAACCGCAACGTCGGACTGGGCAGGATCGACGCGAATCCAA
AGTGTACACACGAAGTCACGTTAAAAGAGAGCGCCTGATGATCAGGCTGATCGTCCGATCGAAAGGTTCGGAGACTTTGCCTGACCGACAGAGGCTACGT
ACACAGTCTCAGTTCGAGGTTGTGTCCACCGTCCACAGTCCAGGACGGCTGCCACAGTTTCGCCCTGTCTATGAGGCATCCGCTTGGAAAGCCTCACCAG
CTGACAGTCGGGCTTCATCAGGTTTCCTGCCAAAACCAGACCAGCGCTGGCGCAGCTGTAAGGAGTGATTGTCTTTCTTTGAGAATCACTTACAGTTTCA
ACAACAAAAAATCTTATAATTTCTACTTTGTATTTTTTTACTTATTTCTTAAAGAACTAATGGAGAGAGAGGGTGCGTAACTACAAGGATCAGAATCAAA
TATTCAAAATGCATTTGGCTTACATGGTTGCTACGATTTGGCTAAGGTATCTGTAGCGAAAGAACTGCATCACGGGTCCAATGTTTCCTTCAACTCCGTT
CAGCTCGCCACCGTGAACACAAAGCTCCAAAAACATGAGGACGAATATCCCGCAGTTGTAGTTGTCAAGTTGTGGAATCCACTCGGCCCTTTGAAATCTG
TAGCGTTTGGGGGACTTGAGTTTCGGCAACAAAGGAAGCACTTCAGCCTTCAGATACGTCCTCATCTTCTTAAACCTGTCTTCAACTTGCTGGGGATCGT
ATACTCTTACATCGCCTGTGCTGAAGTTGACAGCTAAGGCACACCAATGGTTCAAGTCGTAATTGATCACAGCGAAAAATAATAACTTTTCTGCATCCAA
ATCCATGCTAGATTCAGCAGTCTTCAGCTGCTCCCATACGGTATCCGCTCTTATCATCTCTAAATCAAAGACAGGGAATCGTAGGACATCTGACGGAAGC
GTAAAAATGGTAGCTTGAGGTCTCGACCGTTGAACAATCCTTTCCACGACGAGATCTATGCAAGGCCCTTCAACCTCGGTTTTACCGCATAACGAGGTCG
ACCAGTAGAATCTGCTAAGCACTTCAATTTCCTTTAGGCGCTGTATCATCGTCGCTTGGTCTACGATGTCTTCTTTCCACTCAGCTCCAAATGGCTCCCA
TGCAGATGTATCATGCGCTTCAATTCATTTGATGGCTGCTTCAATTCCATCATAGTGAGAAATGATTTCGTGCCCAGTTCGCATAGCTCTTAGCGTATCG
ATTTCATACACCACCCTGCAGTCATAACCGTGACATCGTGTTGAGATATCCGACTTATATAATCGCTGAACCATCGATTCTGAAAGTGAGCAACTTGTGT
GTCGCAGGTGGCTAGTCTTCCTATGGGTAACACATTCATAACGGAGTCTGTTGGAGTGGGTTGCTTTTTCCTCTTCTCAAAGACGGTAATTTTGGCTCGC
TTGATTTGCTGTAGAACTGACAACGCGCGTAAGCTTGGTGCGTGTTTGTAGGTAACACCTTCCTTGATTGCATCCAGTAATACAGCAAGCGAGGGTGCAT
TTCCAGCGGCAACAGCAGCAACAAAACGAGACGTTTGACGCAAAGCCTGGGTCTTCGCCATTTTTCGTAGACTGTGGGTCCCCTTAACACGCCCAGCCCT
GCTGCTCGTTTTGTTTATCGTCCATTCCGGTCGTGCCGATGAACCCATCTCATTTTCGCTTAAATGGGTGCTCGAATTGTCACGACTATCTCTTGGTCCA
GTTTGAATTACCTGCACATTCTCAGACTGGTACAATGTGTCCGGAACATTCTCAGACTGTACGGCGGCATCCGATACCGCCCCGATGTTGCTTGAATAAC
CCTGGTGAAGGCTAGAAGAATCCAGCTCATCCATAAGAGAGTAGAGTGCTATGCTACTCGGCGACAAGTGTGAATTTCCTTCACCATCGAGACGCTCACC
GAGTTCAGTAGGGAGATCTTCATCTTGACAGCAGTCAGTCTGAGATTGTACGACAAGTACAGGTTGTACACCAGTCTCTTCTGGGGCGCCAGGCTCAGTT
GAAACTCCAGACTCAGATAGGATTCCCGCTTCTGAAGGAGTTGATTCATATGACACGTCACGAGTTGAATTTACCGTCCGTCGTTCTAGCGTTTCGTCTC
GATCTGGTAAGCTCCGAATTCTTTCGCCCGGCATAATTACTTCGGGGCAATGGCCAGCTTTCACGCATTGGAGAAACTTCTGCTCCGCTGCCATTAGAGT
GATGTGCGCACTGGTGCCCCACTCGCATCCCACATCAGCTATATGCTTACCCACCGCAAACAGTTCTTTGAATTTTTCGTTGTGAGTTTTCGCACGCGCG
GTCGGTAAAGTTGGCATTTGTCTCTCTTCGTAAGGATCCACTGCATCGTCAGGAACGGGTATCTGTTTCATCTTTCGGTAGTTCTTGACAAGCCAGCGCG
GGTGGATGATACTTTCGGGCACTATATGGTCACAACCAATCGCCTTTCGGTAGAAGATGATTTGTCGGCACGGGAGCAGGCGAGTAACTCGAAAGATACA
CGAACATGTCCAGTTATCCGGATTTATCATGTACTCATCTGGCAAGTCTTCGTCCGTGCTTGAAGTGTCATTGCTTGGTGTGTACTGCATCATCACGTAC
GGACCCAGCGGGTAGTATCTGTACGATGTTGACGACAAGAGCGCAAACTCGTATTGCAGCTTCACCAGATCCACAGCATGGCGCGACACGGTAT