Description :
From Genome Similarity Track
Location :
Scaffold_296:24156- 29620
Transcript NameFunction/comments
Phyke_g7974conserved hypothetical protein
Phyke_g7975hypothetical protein PHYSODRAFT_346958
Phyke_g7976hypothetical protein PHYSODRAFT_346958

Sequence
5464 bases(100 bases per row)
GTTCAGCACCATTGGACATCCATGCATTTGACAAACGACACCTGCATTACCAAGCTTTGAAGTCGTGCCCCGCTCTGTCTGTCTGTATCCACACCACCTC
GTCCATTTCAATTGCAAGAAGAGATTCAGACGATTGCGATCCTTTTGCACTAAATTTCGACGTAATAACCTCAAGAAATGGCTCCTACCAAGCGATTGAA
CCTCAGCAAGTCTCGCGACGACAACGAGAGCTCCTCAGCTTCGTCTACTGACGACGAACAGGAtcagacgcagcagcagacaaaggagcaagagcaggaa
gaggatTCTAGCTCAGGAGAGGAGTCGGACGAGTACGTTTGCAgtcgaattgctgcagtttcgACAGACTCTATGTAGATTTAGATGTGTCATTCTTGTT
GGTTGCCACAACTGACGTGTCATTGCTGATTGCAGAGAGTTCGAGATCCCGCCGGATTTTAAGAGCGTCAAGGGAAGTGCAGCAGTAACACGCGAATCTG
TGCTGTCCAGCGGCCAGGAATTGTGGTTCTTTAAGCTGCCTAAGAACGTAAGTTGTGACGAACGCGTTGACAAATCCTTGCATCGGAAGTTGCCCTATAC
AAGTCGTTGCGTATCTGACGGTGTGTTTGATGTCTTTGTTGTGCAGTTGAATGCGTCAGCACTAGAAAACGTGACGATCAAAATTGGTGAGGGTAAGAAG
GTAACCCCCGGTGAACAGTTGGCCAGACTGACGGCTGGagaggacaagaagaagtacGTACTGCAAAGCGAGGACGGTATGCTGACAGACCAGCTCGTGA
ACGCACTGCCGCTTGCCTCGAACCGTGCCCGTTTTGTTCTGGGCAAACCATTCTCGCGTTGCTTCTCGCTGGTCGAGGACCACCAGGATGCTACAGTGGC
GGCAGTGGCCAGTTCCAAGACTCAGGAAGTTGAGGCGTCACCCGTCGTtgaaaagcgcaagaagaaatccTCGTCTGATAAGCAccacaagtcgaagaag
gccaagcacAAGAAGTAGATTCCCTACGACGGAGAAAATAACTCAGCACTCGATAGACCACAGAACAGCCATGCAAGAAAAAATCATCACCTATTTGTCA
TTTTGTTCTTCTTTATCGGGGTCGTCACACAGCATGGCATAAGGCCTTAGCTTCAACTTCGCCGACAAATGTTTGAAAACACAGAGGTGGTCGTCTAAAA
AAGCAGAAGCGGCTCATCTGGCGGCGGGGCTTCACGGCGCTTCGAGCTCTTGTGCTCcttgtctttcttcttcttcttgctcttctcaGCCTCCCCACCA
TTTTTACTTGAGCTTTTTTTCTTGTGGCTGCTCTTCTTTGTGGATGAGCTTTGGTGACGATGGTGGCTATCTTTCACCGCAAccgcttcttccttgtcaC
TAAAGCCGCCGATGAGCAAGTCGTCTTGTTTTTTTGACAACTTCTTGGATTTTGAGCTCTTTGATGActccttctttttcttcttgctgccatCCTCACC
ATGAGAAGACTTTTTGTGTTTCGagcttttcttcttcgacttctttTCACTCTCCGCTGGCTTAGCGGATACAGTCTGACGGTGAAACCAGTGCTCATCG
GGGACCCTTTCGTTTTCACCGAGCGGGATACTTAAATCCACTGCGGACAAATCAGTCTCCTAGAATTTCACAAAATTGCACGTGTACGAGAGCGAGTGAG
ACAAACCGTACAAAAGAAATCAAGGAATGTCGTTCATGTCGACGAACCTCCTCATCAATTGAATTCCGTTTTTTTCGGGAGCGTCGACGATCTTCATCAC
TTGAACGCGCACCTTCAGGCATCATCTCATCTTCCAAAATGTCCCGGGACTTTGATTTCTGCTAGTCACAAGTACACCGCACGTTATCAGCATTCGTCCT
ATAATCCATGACAGAGCTACAAACCCTACCTttgacgccttcttcttcctgccgTTTATGCTAGAGCCCAGAGCGCCCATTATGTCAGCAAAGCCCTACA
AACAGCccaacacacacaacatTAGCACCGGCTCACGAATAGTTATCGCTCAATAGGCTACTTCGTACCGTATTGGCAGCATCAGTTGACACTTGTGCTC
CAGCAGATAAATAGAAGGGATCCTTGCGTAGCCGTTCTTGTTCCTGCACGTATTCACGCTGccgcttctccttctcatctGCCGAGTCTTCGGATTCCGA
TTGCGAGTCTGACTCCGACGAGGAGCCGTCTTGGCGACGCTGATGATTGTGTTTGTGTCCAGGCTTGCGTTCGGGTGATTCGCCCCCAATGCCACTatag
ccaccaccaacgccagcatGACCCTGGCTCACAAAGGAAACCTCCAGATCATCCTCACTCGAAAAAGCTGACACGTCACCGCCTGACTCAAGGAATTTGG
CCTCTGAGTTACTCAACGGATCGTCAAGATCCAAATCACCAGGTAATGGAACCTTGCGTTGTGCCTTGACACCTACTGGTGCTAACCGTTCTGCGAAGTA
CGAGTTCAGCACATCCAAGCGCTTTGCGGGGTCTAAAGAGGCACTGCCGTCGAACGCGCGCTCGGTACGCTCATGTGCAGAAAGAGCACCCAGACCCATG
CCCAGTgccagcagaagctgctgtagaCACACAGCACGTTCCTGAACCTCAATATGCTCACTTTGAACAAACGCGGGTAACCTTTCCATGATAACCGTAG
CAATACGCTCCACTGTGGCATCATCAGCTCGTTCTGCCATAGCTGTGAGGATTTTCAAAAGCGCTTGAATAAAGACAGTTTGGACGTGGCCTGGCAGCGT
CGTCGTGCGGGGCTGCAGCATCTCATCTGCGAGATCCTCTAGTCTCTGGAgcttttcttcctccgtGTCCCgatcttcgtcctcttcatcctcgtcgtct
tcgtccacatcgtCTAGGTACTCCATGACGTACTCGCCCGTGATCCAGGCTGCCGCATAGAACACCTCTTGTAGGGTTCCAGAACCTGGACCACTCAAAG
CCTCCTTTTCGATCAACAGATCAATCATATTCTCCACCATCACACTACGCACACTCTTCACACGAACTGCAATATCTACAAGTTGACGCGCCACCTCCAC
ACCATGAGAGCGCTTCGGGGGCTCTTCATccgccaccttcatcttgcggttgctgctactgctggagcCAAGCATACTTCCTGAAGACGGGGCTAATGAG
GACAATGACGCGTCGACCGTAGCCGCAGTGTTGCCCGGTACACGAGCAAGCTGGACCAAGACGTGAATGTACCAGTCAAAGTCGTGGATGTTCGCATACT
TATTGACGGAACAAACGTGTAAGATATGCGTGATGAGTTCATGACGGTAGGCTCCGTCGGCACTCAGGGTCTGGCGCATCAGCTCACGGATAATAGGAGC
CGCGTTGTCCGGGTTGACCATGCCggacagcagctcgagcgATCTCATCCGGATGGTAATATCGTCAACGGCTAAGCACTCAACGATCAGTTCCTGGTGC
TCTGTAACAACATACGGATGCGACCTCATCAGGTTACCCAGCCCGACGAGCCCCAAGTAACGAAGATTCTGATCCGGGTCTTCAATATAACGGCGGAGGT
GGTCATTACATAGCCTGACAACCGCCGCCACGTTACGCGGCTGTGAGCCATCACCCTTCTTGGTGTACAACAGTGCCGTTGTGACCGTGTTAATGCATTC
GTAAAGTAGCGACTTGGCAGGCGTGTTCTGGATGACAGTCGCAAGTGGGTCCAGCAACTTTCGGGCAAGACGAGGCTCTTCAGGCACCAAACTGGCCAAC
AACTTGACCACTTTAATGAGCATCCAGTTGTTGGACGATGTGGTAAGCAGTCGGAAGAATTGCGGCGCCAGTCCCAAATAGTTTTTAGGCTTTTTGTTCG
CCAGTTCGCAGATCACGTTCACTGCACACGACACCACCGTCACATCAGGCTCCTCCATGCGCTCTTTCAGGCGGTCAAACGATACTCGCAGTCCTTGTGG
GTACCGTAGGAACATCTTGAAGAGCACCAGAGTAGCTTTCTTGCGTACATAAGGCTTGGGCGACCCCATCATAGCCAGCACATCACCCAGCAAGTCTCTA
GCCAAGTCCGTCGTGACGATATTGGCCAGTACATTGATAGCCAGCCCCACTTCGTGCTCGTTCGTACTGCCGAATTCCTTCTTGAGTAGATTTGTACATA
GCAGCACCACATCTGTAGACTGAGTGAAGCTCTGACAGGCGGCATTGTAGCCAATCCGCTTGTGCGCAAAGCGCTCGTAGCTCATGACCTCCACCACGTG
GAAGGCAGCCCAGCACATATCGTAGCCAAGCATGTGTAGGTACGTGAGCTTGCGCACCGCTTGTGACTTGATGAACGGGTCGGTACTGCGCAGCTCCGTC
TTGATTTCTTGCATCGCCTGGGAGATGTACACGCTCACATCGCCCTTGGTGGAGCGGATGCCCTTGACCAGGTCCTGGAGGTTCTTCTCGAACATGATAT
CTTACTTCTTCGTCTGATTACGGACGTTCTAGAGTGGTGTTAGCCGATTGCAGCACAGCGATATAGAGTTAGGACACGATGTTGTCGATGGAGACTGGAT
TTGTGGCGCACTCGGTCCCCCCGCCGGTGAACTGTGGACGCCAAGCGCGAGTGTCCCGCTGCGTAGCGCAATGCGAATCAAGAGGCCGAATGATCGCAAG
GGGGgaagtaaaaaaaaagacgattttggccaatcaacATGGCGAGGATCTTTCCATACAATATTGCAGATTACAAGGCTGTGCACCCTGCAGATGGCTA
CATGGCTACAATGTGCCAGCGTGCCAGCGTGCCAGCGTGCCAGCGTGCAATGATGTCTGCCAGGATACTTAGGAGGAAACAAACATGCACATGTCCTGGA
CGCTTCAAAGCATACACATAGATTTCCCACTTGACTTGAACGATGCATTTATTTTGTTGCAACTCTTGACTTGTCATCAATCATTGAAACTTCACCCCAT
GACGAGCTCCAACAGAATCATCAAAGTGTTAATGACCATGAGCGGGACTGCACGCAACCAAATAAAAACAGCACAAATAGAATAGTGTTCGGAGAGGTGA
GGACACAGATATTGGTAGGCAGGAGCTGTGCTCCACCACTTGCAACACAGTCAGGTAGCAGACAACATACATCGGAGGTACTGGACGGCAATGAGGAAGC
CCACGATCTGGTTCTTGATCGTCATGCCTTGCGACGAGTCCACCTTATCCCAGCCATCTACACGGGAGCAAACACAGCAGAGAGTCAGTAATGCACTCAC
CAACTGTTCGACATTTACCCCGTGACAAGTATCTAACGAAGCAGGGTCGTGGGGAGAGTACGCACGTGAACGCAGGAACCGCTTCTCGTGCAGAATGCAC
ACGGCGTTCGTGAGCAGCAGGCTCGTGAGGAAGAAGTTCCACAGCACGCCCATGTCGCTCGCTC