Description :
From Genome Similarity Track
Location :
contig_65:241505- 243312
Transcript NameFunction/comments
g11785.t1hypothetical protein

Sequence
1807 bases(100 bases per row)
TGAGCGCGTTGGGCTTAATACAGCGAATAAAGTTGCACCGCGTCGCATCGAGGGTGTCCACAAGCTCCTGCATCTGGTTCGAGAACTTCGCAGCCACACT
CTTCGTCAATTTCCTCTTGCCGGGGCGGCTGTTGTCGGCCTCCTGCTTAAAGAATGCAGGCAACAACTTGTTCGTCGAGCCCAAGAAAAGTTTCGCCATG
TCAGGCGGAATCGAGTCGTTGTTCTTGTCAATGAAAGATCCGATCGTGTAGCTCACAGCACCAGCGAAATGCCTCACAATGAACATGTGCTCCATGTCCT
TCGGGTGTGGCCGCGGGAAGTACGCGTGTCTAGCGTGCTTCGAGTGAAGCGTTCGTAGGAATTTCGCGTCGCTAGGCTGTGGGTTCATCGCCTCGGCATC
CAGCAAAGCCAAAATACCGTTGGGCTTGGATGCAATCAAATCCACGCACTCGCGGTTATCAGGCCATTTAATTTTGCCCACCGTGATACCTTCACGCTTG
TACAGTTCCATCTCGGCAATGAACACCTGGTTGTTAAACGTAGCCTGCAGCACCTCGTTCGTGTAGTTGATCAACAGCTGCTCGAAATCGTTGCGCTGGA
ACGACTCGAAACCGAAGATATCTAACACGCCAATGTAAGGCAGTGGGTTGGGATCGTGGCCCAGAGACGAATTCACTTGCTTAATAACCCAGTCGAACAA
GCGGCTGTACAGCGCCTTGGCGATAGCGTCACGTGCATACACGGCAGCCTGCTCGTTGCGGCGAACAGTGAACGTCTGTTCGGGCGTCACAATGTCGCGC
GTCATCATCACCTTCCACAGGTCCTCCTCCTTCACACCCAGCAGCTTGGATACCACAACAATTGCTCGCTTGGCAGATTCCTTCTCGATCACGGCAGCTT
CACCCTCGGGCGTATCTTCTTCTTCAAACTCGATGTTACCCAGATGCAGTAGACCCGCGACTACCGAAAAGATAATGTGCTGGACCTGCTCGTCGATGCC
CACACAGCTCAGACCACGCACCACAGCCTCGAAGCACGCGTGGTCGTCCGTTTCTTCGGCAATGTAGCAGCCGCTCTGGTTCAGGTAGCAGAAGTCCTGG
GGCTTCGTCAGCTCAAACTCCTTACGAGCCGCAGCCGAGGCGCCGGCCAGCAACTGGTAGAAGATGTGGAAGTTGCGCTCGCCATCCACTTGGTACACGA
GACGCGACTTTTCCAGCAGGTACGTCTCGACCAGAGCACCGGCCAACTTGAACTCGCCGTCCGACGTGAACTGTAACTTCATGAACTTGCCGAAACGCGA
CGAGTTGTAGTTGCGCAACGTCTTTGCGTTGCCGAACGCTTCCAGGATCGGATTCTGTTCGATCAGACGGTGGTCCAGCGACGTGCCGTGCTGCTGACGA
GTCTTAGACAAGGTCTCGATCTCGTCTCCGCGCGCCTTCTTGCCGTACAGGCCGCGCGTGGTCAGGTGACGCAGCACGATCTTGGACGACTCGGTCTTGC
CGGCGCCACTTTCTCCACTGATGACGACTGACTGGTTGGTCGGCTGGTCCGTGCCCGAGTTGTAAACCATTTGCTGGTACGCCATCTCGGCAATGGAATA
CGGGTGGGGGGAGCTACCTGCCGTGTTGACGACCTCGCTAATGGGCGGGTTGGCCAGCTCTCGCAGCGGGTTCACGGCGATCAGCACGTTGGCCATGAAC
GTGTAGGGCTTCTGGCCGGATCCGTCGCCGCCGTCGAGCTTGCAGCGCTCCTCCAGGTTGTGCAGCACGCCGGCCTCGTGGATGTAGTAGAGCGACGTCA
TGTCGTC