Description :
From Genome Similarity Track
Location :
Scaffold_46:241501- 246701
Transcript NameFunction/comments
Hyaar_Emoy2806138elongation factor P, putative
Hyaar_Emoy2806139spastin and Fidgetin-like protein
Hyaar_Emoy2806140U4/U6.U5 tri-snRNP-associated protein, putative
Hyaar_Emoy2806141pyruvate dehydrogenase E1 component subunit alpha

Sequence
5200 bases(100 bases per row)
TTACAGCTTGTCGACGTACGAGCCGTCTTCTATGGCCACTTTTACCTGGTTGCCGATCTCGATGAACAGCGGCACCTTCACAACTGCACCGTTCTCCAAC
GTCGCATTCTTTACGCTCAGCGCCGTGTCCGCTACACCTTTCGGGGTGGTTTTCTAACCGCACATTTAAATCAAAACAGACGGTCCCGACACGAAAAAAA
GCAACGTCAAAGCTGCGCCTGAAATTGTGAAACATTTCGAGCGGCACGCACCGTAACTTCGAGCGTCACGTACTCCGGCATGTTTGCCCACAGCACGTCA
CTCTCGATGATCTGCAACGACAGTGTCATACCCTCTTGTAAAAAGTCTAGTTGGCGACCCGAGAAAAGGCCACGCTCGATCTCCATCTACATACAGAAAC
AGCAAGTAACTCGGTCGATCGTTGACTTTGTGTCGACTCTACACACTCAAAACGTTCCTCGACGCACCTGATCAAACGTCGTGTTGTGCATGACGACGAG
GTGGTCCCCATTGAAGTACAGGAACTGAAACAGCTCATCCGGTCCTAGTGGTGCTTTGTTCACCATCTCTGCAGCTCGAAAGCGACGGTTTATCTTCGCT
CCACTCTTGATCTCTCTCAACTCTGCCTACAAACACGCCGTTAATCACTGACACTCAATACCGAGCCATTTCTCGTCCACTGATGCACAAATAATCACAA
AAAGAACTCCAATCGAACGTACTTGCACGTACGCTCCACCTTTGCCCGGTTTCACGTGCTGGTTCTTGCCGACGCGATAGATGACGCCGTCAATCTCGAG
TGCCATTCCTGCACGGACTTGATTGCCTATTCATTTGAGTGTACCCCAGCCAATTCAATGCATGAGACGATAATTCCAGCGCAACGATAAAGGTCTCTAT
CTTATACACAGTATCGTACCATTGATCGAGGCAAATCGATCCCCATAGCCACGGGCAGCTGCCGTCACCCGCGCCACTTGTGTGATCGCTGTACGCAACA
TGCTCAAAACGTGCACCTAATGACAAAACCACTATGCGGTGCTATGATTGGCCAAATAGTTTGCATATTACTTTCTTGTGTCCCATCCTTGACGTAGACA
GGATAAAATTCCAGCACGAACAAACGTCAACGATTGGCTAAAACGCATTATTGATGGTTCATTCTTCAATTATCTGATAACCATGTTCCTCTGGCGCTCT
CGTCCTCGGGACGATGCCATCCAGCAGGTGATGGAAGCTGCAGTAGCGGCCGACAAGGCGGAGAAATACCAGGAGGCAGTGGATCTGTATGCTTCCGGTA
TTGAGAAGATGATGACGCAGCTTTCGCGTACGTTGAAGTGGGACGTCTGCGTGTCTATGTGACCAATACTACACCCTTGTTCAGTTGGCTGAGTCTTTTG
TGTGCAGAGCTATCGGACGATCAAGCCAAGAAGCAATTTCGGCAAAAGATTAACGAGTATATGCTGAGAGCCGAGTATCTGAAGAATCAGATAGTGGAGC
TGCACGCACTGAAGCAGACGCCGGTCAGTTGTAGAGCGACAAGGACTGTTTTTACTGAGAACGAGGCGGAGTGCTCGTGAATGTAGAGCGTGTGGCCTGA
TGTTGCTACGTGTAGAGAGCAGTTGGGCTCGATGCTGTTCTAGGTCCTGCAGAACGCACTCCAAATAGCCAGCAGGTTGGAATTGCTAAGTGTCTCGATT
TGTAAACTAAAAAGATGTTGGATATAGCTAGCTGACACGTGTCTGCTAGACAAAAAGAGCAAAGTACATGAAGGAGCACGCAGCACATGCTCATGCTATT
TTGGACGAGGTGCTTGACCACTCACCAGGGGTGCGGTGGTCGGACATTGCAGGATTGAGCGTTGCAAAGCAAATTTTACAGGTATTATCATATGATTCTG
TGGATGTTCGCGATCTTGATGATCAGGTCGACTAGACGAGCCTGTTATGGACGATGACGAGCAGCAGAATTGACGGATTGATGTGCTGCTTTTATGGCGC
AGGAGGCTGTCATACTACCTACATTGCGACCCGATTTGTTTACGGGCTTGCGGGCCCCACCTCGCGGGGTGCTTTTGTTTGGTCCGCCGGGAACGGGTGA
GAATGCGTACATTCACGCATTTCGTGTATTATGTACGAGTCAATGGAGCTCGCGAAGCTGACGCTGCGTCTTGCATGGTGATAGGAAAGACTTTGCTAGC
AAAAGCTGTCGCTACGGAGGCGAATGCAACTTTCTTCAAGTCTGTACATGCTACGATGCGGCTGCTTTGTGCTCGATGGGTTGGAATGCTTTGCTGACGA
CTGTTTGATGCAGCATTTCTGCGTCGTCTTTGACGTCCAAGTGGGTTGGTGAAGGCGAGAAGTTGGTTCGAGCACTGTTTGAGATGGCACGAGAGCTTCA
GCCCTCTGTAGTTTTTATGGACGAGATCGACGCGTTGTTGGCGGCACGATCGGCATCAGAGAATGATGCGAGTCGAAGGATCAAAAACCAGGTATGTTTG
ACGGAGGGGTGCGTTTGGTTATCCGATTGAAATGCTAGCTGAACACCTTTCAGTTTTTTACTGAACTAGACGGAGCGGCATCATCACAGGAAGACCGGAT
TCTTGTCATGGGCGCTACGAATCTCCCACAAGAGCTGGATGAGGCTATCATACGACGCCTGGAGAAGCGCATTTACGGTAAGTAATGATCATTGAAAGAG
AAGTTATGTGTTGCTGACCCTGAGTATGGTTGTGGTAGTGCCTCTTCCAGATGCTTCTTCTCGTGAAGGGCTTTTCCGGCATCTACTTGGCAGCCAGAAA
TTCTCTTTGTCGTCCAAAGAGATTAATCGCATAGTGAAGTCAACCGAAGGCTATTCCGGCAGTGACCTCAAGGCTGTGTGCAAGGATGCTGCCTTGGGTC
CAATCCGTGAGCTTGGTGCAAAAGTCGCAAGTGTGAAAGCTGAAGACGTGCGAGGAATTAACGCATCCGACTTTCAGGTGGCTCTCAAGCGAGTACGCCC
CAGCGTATCGGCGAATACGATAGAAGCCCTCATCGCATGGAATGAACAATATGGAATGGCTGCAGCATGACAAATACGTCTTCCATTGCTAGATTGTCGA
AAGCAATCATGCTTTTCGCTCGTATATCATCAAGTACGACTCGGACACGCCAATCAGCTGCGGCATCGTTTCCTGAACATGCAGATCTTGAATTTCGTAC
CATTGCTCGGTTGCCTGTTACAAATAAGCGCACAACGCGAATGAGTCTGACGTCGTTGACCTCGTGTACAAACATTGAAGACCGCGTACTCTATTCTGAA
CGTGAACGCGATAACTCCCTTCCGTCAATGGATTCGTCTTCAGTGCTGCTTCTCGGCCAGTTGTCACTGGGCTGTCATGGCAGATATTTGCAATCAAATT
GTACCTGATGACAGATACGCGTCGCAGTGACAAATTGAACCATGTAACTTCCTTCGACCACTACAGCATGCAAACAACAGCACGTACTTCGTTGATGGCA
GCGTAGTGGGCAAGAGCTTCTCGATCAAGTCAGACTTTTCGACACAATCCTGCAGTGACAAAAATAGACAATCGAATCACTTCGACCTTCTCCGCGTCCG
TAAAAACAAAAAAGTTGATCGCACCTCAGCGGACTGGTCCCGATCGCGCAAAAGAGTTCGCAGCTCAGGAATCGACATCTTTCGAAGCTCTTCCTCCGAC
AGGACCTTCTGGTCCAGGGTCAGGTAATCGCGCAACTCGAGATTCTTGACAGGAAAGTTTACAATCGTCGGGTTCTTTTCGATGAAGAAATTATTTCGCG
TAAACCGCTTTACGTGGAAGATCAGGTAGGCTGGCAGCGAGTCGATCCGGTAGGTCTTCTTGAGTCGATGAGAGCCGTGAAGCACGTGTGTGACGTGAGA
ACCATTGTACTTTTCAAGCACTGTAAATAGTGGAATCTACACCAACAAAGCGATGTGAAACGTCGGCACGCCACTCTAATACAACAAGAGTGTTTAGACT
CAATTGCGCTTACCTGAGGAATGACGTTTCCACCTTGAGAATCCTTGAACAATGGAGTCGACGGCAAATCGAGCGCCATCATCCTACAATCACAATGTCT
CAGTCAGTATTGCACGCACAATAAACAAGCGATGAGTGCAAGTGACGTACAAGAACGGCGAAACTGTAGTAGAGCTAGCTGATTGGCACTCTGCAATATC
CGCTGAGGCAGCTTTTGTTTCGTCGTCTGTTGCCACCTCTACGAAACCTTGGAAGCATCTGTAGATGATGCTGCTCCCCGGTTTGCTCGATCCGCCAAGC
CCCTACACTCGCAGTACATTGCATTAGTTCTAGCATTTGTTACGCACAAGCACCATCCTTCTTCTCCCTTTCATACCCTGTGCAACTGATTAAGCAGCCA
CGCCAACAGATCAACACTTTCATTCTGTGTTCCGACGTGAAACCGCTTCTTGCTGCTCACTGATATCTCCTGCACGAGTTCATGCGGACTAATCTGCAAC
ACAAACGTCCACAAAAACAAGAGCTTCAATCAGCAACCAAATCCAAATCCAACTACAGCACATCTAGCACAAGATGAACCGTGTTCTTGAAGTTGTGTGG
GCTCCACATCTTGCGCATGATCTCCCCGAATCGCAGCACGAGCTTGGACTTGACTTTCTCCATCTTGTTGGCCAAAAAGAAGTCTCGAAGCGGTGGTACA
TGCGCCAGCGCCTGGACCACGACGTTAATGTAGTCCGTGCGCTTGAGATTGTTCAATCCGATGAATCCAGGCAGATACGAGACACCAAACGCGTCTTGCG
CCAAGATGCGGTTCTCGTCCAGCTGTGCGATCTCTTTGGCTGTAAACGTCGGGCGAAGTGCGTCCTGCACCGACTTGAGCGTGTGGTCCACGACCTCGTA
ATTATCCGGTAGACAGTAGATCCGGTCCGTCTGGAGATTGATAAACACGTGGTGACTGCTCTGGACCGAGTGCGTGAACGCGTGTGTATTACGGCCACGG
CCCTGGAAGTACTTGCCACAGACGAGACACGCGTAGACGTTCTGGTCGGATAAGCTGATCGAGCAGACCTTCTCAAAGTCAAAGTCCAGCAGTTGGTGGC
TGACTGTGTCCAAGTACGGACACTTGCGGCGCTTGGCGAATGCAGCAGCAGCCGCAACGTCGTCGTCTGTAGCCACTTCAGCTTTGCGCTTGATGGCCAT