Description :
From Genome Similarity Track
Location :
Scaffold_10:2415- 6272
Transcript NameFunction/comments
Physo_130043pol protein

Sequence
3857 bases(100 bases per row)
CGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCTGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCA
TGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGTCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGA
AACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAGCCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTC
TGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGTGTCCGAGCTGAACTCGTTCAGCT
CGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGCCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTTTTGCTCTTGTCGGCGTCTGT
GCCCTGCACAAACGCGCGGTTCTCGGCTTTGCTTCGTGTCGTTGCGGCTGACACTGTACAAGCGTTAGCGGCATTCTGCGGCTGCTGTGTTGGAGTCGTA
GATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGG
CATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCG
GTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGCCTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCA
GTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGTATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTT
CAGCGGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCTATGGCTGTCCGGGGGAAGACCGAACACGAA
GTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAA
GCACGGACGTAATTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCG
GTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACACGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAA
CCCGTCGTGCACCCGGTAACGGTGTGCACAAGCACGAAGATGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGC
GTACGCGACCTTCACGTCGTCCAACAGTGACGACATTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGT
CGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTT
GCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAG
TGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCC
TCGTGATCGTGCTGCATCAACGCATATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCATGATCGGCG
CCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAATCCACTCGACGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTAT
CATGCCCGCGTAGTCTTTCACGTACTTGCACAAGTACGTGGTCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATC
ACTCTGACCTTCTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGCGCAGATCAAGAGCACTGTAGATAGTGCT
CCTGGCCATCGAATCCATGATAACATCTTGTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAA
CCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGAAGTCGTCGA
TCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGG
AAGCTCCGCAGGGGTCTCTTCCGGAAGCACGTCCGCGTGCTTCCGTAGAATCTCGTAGAAGGGACTCGACTTCAGCGAGTCCCAGCTCTGCTCCTCAAAG
CGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCACTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGG
CGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGTGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGATCCTTG
TGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGCCCGGCTTCTCTGCCTCCGTC
TGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGACGAGACTTGCACAGCAACCTTTGCATGCGCCGTCTTCTTGTTCTGCGGAGCCCGGCTCCGC
TTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGATCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTC
GCCCGGCGCTTCGTCGTGCGGCCCGGCTGCACGATAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCC
GGAGCCGACACGCCATCTTCACCTCGACGCCAACCATTGGCAGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCA
ATCCATCGACTCCCGGAGTCGACGGCGTTTCGTCACTTTGGCTCTTAATATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGC
GTGTGACTTGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACATATTTTCTCCT
TCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGTGTGCTCGCGCGCGCCCAGGGCGCTCCTGGACAGCGGCATTAGGCGCTGTCCTGACTG
GAGAGTCGCGCGCACCTGTCGGTGCGTGCGTTGCGGCAACAGGTCCATCGCTCTCTGTTCCGCTATCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCA
ATCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT