Description :
From Genome Similarity Track
Location :
Scaffold_778:2415- 4898
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_778-fgenesh-gene-0.0Intraflagellar Transport Protein 57

Sequence
2483 bases(100 bases per row)
CAGTCGCCAGTCAAGCGCAAGAGCATCACGTCCAAGCAAATGGCCGAGAGCGCCGCGGCCCCCGGGCCCGACCACGGCGCGACCCTGGCCATGCCCATCG
CCAAGTCGCTCGCGGCCTTGGAGCGCACGCACCCGGCGCGCAAGGCGAACCCGCGGCGCTGGACCAAAGAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACGCGCTGCGCCAGGCCGTGGAGAACCACAAGGAAAAGAACTGGAAGGCCATTGCCGCCCAAGTGCCCGGCCGCAACCACACGCA
GTGTCTCCAGCGCTGGACCAAGGTGCTCGCGCCGGGGCTCGTCAAGGGCCACTGGTCGCCCCATGAAGATGAGCTGCTCAAGCGCCTCGTCGCGGGTGGG
AACAAGAACTGGGGCGAAGTGGCCGCCAAGATTCCGGGCCGCACGAGCAAGCAGTGCCGCGAGCGGTGGCACAACCACTTGGACCCCAACATTGTGCGCG
GCGCGTACTCGCCCGAAGAAGACCGCATCATTCTCGAGGCGCAGGCGCGGCTGGNNNNNNNNNNCGCTGGTCGGTGATCGCCGCCATGCTGCCGGGGCGT
ACGGAGGACGCTGTCAAGATCCGGTGGAAGTCGCACTGCCGGCTGTGGAAGGCACGCAAGTATTTAAGGAAACCCGGCGGCGACGAAGAGCTTGGGCCGG
ATCCGGAGATGGGCGGCGAGCCTGAGGATGACTCTTCGGATGACGATGGGGACGAAGGAGAGGCCGGTGGCGACATGGGCGACCAGAAGCAGACGCCCGT
GATGGCGGCGTGAGGGAGATTATGACTGATGGATGGATGAAGAGAGGGAGCGCGACTTGACGTTGAAGATGCTGGAGCTGCTCGTTAGGTTCGCTGTGGA
CTGAAATAATACTACTATGCGTACTTTCTAAAGTTGGGGAAGATATTATAACGGCAACTGCATGGGGACGGACGGCTTTTCGCGACTCCCTCCGCCCTCC
TCCCGGTAGAGGAGCGGGGAAACCCACGAACAAGTGTCTTGGAGGAGCGATGGCGGACGACGGAGAGGACGGAGAGACCCGCATCAACGAGCCCAAGGCC
TCGGACACCCCACCACGCGATGTGAGTTGGTTTAGATGCACCTCGAGAGGAGGGGGTCCCCACCGTGGACGAGGGGAGGGGATCCATAATGCAACCGTGG
TGCAATGTAGGACGTGGCTGTGACGCTCATGGGCAACGTGCTGGAGAAGCTCCGCATCCTGGGCTACGAACGCGAGATGAGCAAGAAGAAGAACTTCGTG
CCGTTCACAGAGACACAGTTCGCCTACCTCACCTTCCACCCCAAGTACAAGCTCCTCTTCCTCTCTCGTCCTCCTCCTCTTCAGAACCCTGACCATGTGC
ATTCACCAGTGAGCAGATTGAGACCTTCTTGCAGCTCGTGCTGTACCTGCTCAAGCTCTGCGACCAGGCATTCACGGTCGACAAGTTTGACGACGTGACG
TCCAAGACCAACAAGCTCATCTTGACGCTCAAGTCCATGGGCTTTGCGCTTGACTACTCGGCCTCCAAGCTCAAGCTCGGCTACGGTGAGGCCGCGTGCG
CCACGCTCGACTTTATCTGCGATAAGGCACTCGGTGCCCGCAATTTCACGTGGCCGCGGCCATCGTACCCCAAGGAAGACTTTGCCGACGAGGCCGAGGT
CGATGAGGACGCCGAGATCGATGGTGCCGACGATACGCACGGGGCTGGAGGAGGAGGTCCAGAGGACGATGAGGAGGAGCTTTACAGCGACATTGTGCGC
AACGGCAAGTCGGGCGACGGCAGCTCGCCGCTCGAGGAGAGCTACCAGCAAATGATCGTGAGCGACGTGGACCCACTGCTCTGGAAGACAGAGCTGGAGC
GCGTAGGCCCCCGACTCAAGGTCTCAGCCAAGGAGGATGATGGCAAGGAGTGGCACACGCATATCGACCGCACGCGCAAGCACGAAACGGCCATGAAGGA
GCTACTGCCGCGCGCGACCACGCAGCTCAAGCTCATTGGGGCGACGCTGCGCGAGATCATCGAGCGCATGGGCGCCAAGGAGAAGCAGCTCAACCACCAG
TACGAAACGCTCGGGCTCGAGTACCGTGCGCTTCAGGAAAAGCTCAAGACGATCAGCGATAAGTGCAAAGACGATGGCGACCGCGTCAACGTCATGAGCA
ACGAGCACGCCGCGATCACCGAGCAGCTGAGGGACACGAAGAGCGTCATGGACGACCGCGGCAGCAAGATGACGGACACGACGCCGCTTGTCGCGATTAA
AGACGCGCTCAAGACTCTCAGCGCCGAGATCAAAAACTTTGAACTCCGGATCGGCGTCGTCGGCCACACGCTTATGCAGGCCAAGGCGCGGCAGGCGTCC
TCGGGGATGCGGCGGAAAGGCGGGGGCGGCGGGTACCAGGACCCCGAGTATGACCAGAGCGACGAAGACTCGAGCTGATGTGG