Description :
From Genome Similarity Track
Location :
Scaffold_21:24147- 28278
Transcript NameFunction/comments
g2204.t1ETK71089.1 hypothetical protein L915_21608 [Phytophthora parasitica
g2205.t1RAW34719.1 hypothetical protein PC110_g8958 [Phytophthora cactorum
g2206.t1RAW34728.1 hypothetical protein PC110_g8957 [Phytophthora cactorum
g2207.t1hypothetical protein

Sequence
4131 bases(100 bases per row)
AGAGTAGAGATGAGCAGCGAACTATGAAAGGGAGCACTGACGAGCCGCGGCTCGAAGAAGTGAGCGTGTCAGACATAGTTGAGCAGGAGAAACAAGATCC
CAACCTGAAAGTCAGCACATCCGAAGGCGTGACTTCCCAGCCGAAACCTAGTGATGCAACGCAGCCGACTGGCGTCAATATGAAGGAGAAACCCTCGATG
AAGCAAAAGAGCCGTCGCAGTCGCCAGGCCAAGAAGTCTTTGGATTCGGTTGTCGTGGACAATGTAGAACTCACCGCCGCTACCGGTACGGTATAAATGG
TCGACAAGCTTTTAGTTTCAACGATAGTACTACGAAGAAGTACTTCGAAGTATTTTTTTTCTATTTGCCTGCTTGCCTGCTTGGCTGCATGCCTAGATCA
ATGTCACGATCAATATTATTTGGAGACGCTAGGCCCACAGGCGGAGACATGCTTCATGACAAGAACAGCGTGAAAGAATTTTGCGAAATAAACCGCGTTT
CACGAGTACCGGTACAGTCGCATCGCAAATTACACCACGGACGCTGCTTCCGATGAACTTTGAGCTCCTGTGATCGCGTCGCGTAGGACCTCGGCTAAAC
GGTAGAACTTAGCGCTCTCGAGTTGCGCGTTGTCGCGATTTGCCTCGCATACCTTCTCCTGCAAAGCGATCTTCTGCTCCATGTGCTTCTCTCGAAGCGC
TAGCTCGCGCTCTCGCAGTTCGACCTCCTTCTTGAAGCGTACTTTTTCGAACTCCAGGCGCTCGCGGTCCAGCGCGATCTGCTCCGTCAAATGTTTCTCG
TAGTCAAACGTGCCCCGTGAGTTAGTTGTTGACCCTGAAGCCGCACCTGAAGCTGCACCATCAAATAAGTTAGTAAGCGGTTTACAACTAAAGCAAACTG
GGCACTTACCGTTGTAAGTCTGACGTGAAACAAAGAATTTAAACATTCATCAACACAGAATCACAATCAGCCCCAAGTAATTCAACCTGGCTCACGCAGA
AAAAAAACGTACCAACGACGCTGTCATCTGCGTCCCGCTTTGATTCGAAGTATGCGCGCTGTGTGCTGCCTGTGCAGCTGCAGCTTGAGCAGCAGCATGT
TGTGCTTCACTGATCGCCGCCGCCTGTGCAAGCGCCTGCGCCTGAGCGTACGCAATATCCGACTCTGCATTCAGCACCACGTCGTCCATCGGCAGGTCGT
ACGTCTGCAGCTCACCGTGCAGCTGCAGATAGCGTGCACGGAGGGTCTCCTGCTTGGGCAGCACCTCGTACTCGGACCACCGACGTGGGTGGGCGCCCTG
CAGGTGGCTGCGGATGTTGTCCACCCGAAAGGCCCGGAAGAACTTGGTGGTGGTTAGCGAGCGCCGCCGCCGCTTCTTCGAGTCATTGCCGGCCTCCTGG
TCCGCCTGCACCAGCTGCTCGTACTTGTCCTCGCGACCGAAGGCCTTGCAGAAGCCGCACATGGCCAGCAGCACGTCCCCGGACACGGAGTCGCGCTCGA
TAACCAACAGGCCGAACTCCATCTCATACTTGGACTGCCAGTTGTGGCGTCGCCCCTGCTTGTTCAGTGCGCGCCGCTTCTGCGACTCCTTGTCCTCCTC
GTCCTCCTCTTCGTCCTCGCGCTTGCGACGCGCATCCGTGAGCTGTTCATTGTCCTCGAACTTCTCGAGTGTCGGCGGCTCCACGAGGAGCTGGTCGCGC
GCCTCCATTGTATGCACTTAGTGTCCACCACCCAATTTCAGGTAGGACGTACTTAATAGTAGATATGGGACTGACTTCTCGAAAGACCCATAATTATCTC
GTTTAAGTACGACTTCAAAGTTGAAGTTGTGCTGGCTAAAGTTAGGTGGTATTGTTGCTACTTCTGCTGGCGCCCAGATTGCACGACGGACGCCCCCAGC
ATGGCGGACGCGAGCGGGACGACGAAGCCGCGCAGCGAAAATGGCCGGCGACGCAGCTCCAGCGCCAGTGTGGCCAAAAGCCAGAGCTTAGTGGAGGCGA
AGGAGCTGAGTAAGCAGAAGTACGACTCGCCGTTCGACGCGAGTCTCGTGACGGCTCGTAAGCGCTCGCAACAGGAGCGTCTGTGGGAGATCTTCACGGC
CTACGCATTGCAGATCTCGAGCGAAGACCCCACTCGCATCCGCATCGTGAACGTGGTCAAGCTTCTGCAGGACTGCGGCATCATTGACGGGAACAACACC
GAAGAGGCGAAAATGATCGAGAAGGAGGTCGCCATCGTGTGCGAAGCGTTTCTAAAAGCCCACCCAACTGATCGCGATAGCAGCAAGAAGTTAGATTTCG
CTGCGTTCCTGGCTCTGCTTCTGCATTTCGCGGAAATGGTGCGGAGCATTGGCTTACATTTGATCAACTCTTGACTGTTTTTTTTTGCTGTTGTTTCATA
AAAGTCAGGAGACCGGGATCCAAGTCGAGCATACGACTCACTAGTGCGCACCTGTCTGGAAAAGCAACAGAAGTCGAGGTATCTTGGCTGCGAAATATCT
CAATAGGTTGGTGCTAACGTGGGCGATGCTTAGAATCCGTGTGGTAGTCGTACAAGAAATGCAGGATTGCAAGAAGGTTCTTTCTGCGTTCGAAGACCCG
CTTACGAAAGTACGTTTCGATCCTGCACCACGATTGCAGTGCTTAACGTAACTATGCCATGGGTGCGTTAGATCTTCATATATTACGCAGCGCAAAGTCA
TAGCAAACTCGAAAAGATCGACACGAAAATGGCGCAGTTCTGCCCTCCTCACTTGAGCTACGCGGAGGCTGTCGCTTTTGGGCGCAAGTACGGTATCATC
GCACACGGTGTGCTAACGACGACCGAGTTCGCAAGCATTTACATCGACAGCCTCCCCAAAACTCCTACCACAGAATACGAACGGGTTTTGACATACGACG
CATTCTGTGAGATGCTCGTGCGATTATCGAAGAAGACGTGTCTTGATATAACCCTTCCTGCGGATCGAAATCTGAAGTACGCGTGCGTGGCAAATATTTC
CTCTATTACGCATTGCTCACATTTGTGTTTTACCACTCCAGGGGGTTACTTCAAGTGATGTGGCTGGCTTTGGCGTCTACTTCGCCCCGCGCTCTCAAAA
TCACAGACGTCCTCAAATCGGATCGGGTCGATGTGCGTAACAGCTCTTGGTTGCTCATAGTTCTTGCAAAGAATGAGGCTAAACACTTTTTCAGGTCACC
AAGCACTTCCTGATCCATTTTGAGAAGTACTGGAAGAAAGAACGCTACGAGTACGTACTTGCTTTTTGCTCTTTTCATCCTTATCGTGTTCATCATCGTT
CTGCTTCGTGTTAGGAACTATTTTGGAGATCGACCGACTTCCGTACGGCAGACCGTGATGAATCCACCCTCTCCACCAAAACCACCAATGTCTCGTCGAT
GGAGCTTGAACCCGCCGCCAACCAGCAAGACAAAAACGCTTCAGCGCAGGCTTAGCGTTCAGGCTCCTCCACCTGCCCCAACTTCGCTGGAATCCGAGGC
GATGTGAAATGCACGCAACACTTCTAGCTTAGCTTTACGAACGTGTATATTGTAGGTTGCAGTCATGAAAATATGGACATGGCTCGTGTTGTACCTGCTG
CACTTCTATTTGCTACTGCGCTGTGTAGTGGGTAACTTCTGCTTATAATGCAATGGGCTGCAAAAGCGAGAAGCTGCCAGTACCCACGCGCGGCGGCTGG
CCAAGCACCAGACGAGCGGACGGACTCTCCAACGTATCCACCAGACCACCCAAAGCGGCCTGCGACAGGAACTTCATGGACGTCTCGAACGTAATTTGCT
GCAGGGATGAGCCCTTGTAGTTCATGCCCATACGGTTGAGCGGCATGTACCCGCCCTGCGCAGTCATGTAGTCGGCAAGCAAGCTCAAGTGACGAGGATC
GACACTGATACCGTAAACGCCGAACACGTCCATAATCTGCTTCGAAATACTTGCGCGAGCGGCCTCAACGCCGTAAGTCTGTAGCACCTTGTAGACGTCG
TTGGTGGCAAGGTTGTTGACATCCAGGATGTCGTCGAAGCCCCAGATCTCCTGGAAGTTGAGACCCTCCGTCTGCACGCATGGCTTCTCCTCCTGCGCCT
CGCCAATACGCTGGTTGATGAGGTAGCATCG