Description :
From Genome Similarity Track
Location :
scaffold_5:241444- 244379
Transcript NameFunction/comments
Plaha_PHALS_14002creatine kinase

Sequence
2935 bases(100 bases per row)
TGAAAGTCGATAAGTTATGGGTCATTATTTTCTGCCCTCTCATCTACTTAAGTGTTTACGAGAACTGGCGACAACCCTCTTACTTCGGCGAATTCTCGTG
TAGGAAGCCCAAGTAGAAGCTGGTAATACCGCAAAgaatgtcaaatgcaccagcgtcTTCGAACGTCTGCTGACAGAGCTACCCGTACCACACATTTGTT
ATATACAAACTTATTTCAACGATGTATTGACCCAAGTACGGATGTGGAAAACTACATTCAGCACTTGAGATCGGTGCGTGTCAAAAAGACGCTTCACCAA
ATTTTAATAGTGTTTTTCTTAAGGGGGCAAGATCCTCTTTTCGATTTGCTTCATTGTAATTTATGGTCAGTGtgcaaattttaaaagaGTTAAGGATATA
TATTCGTCAGTTTTCAATCCTAAAAGGACTTTAGAAGATGCTTAGTTGGACCAACCAGTAGTTGCAAATTGAAGTGAAACCCATGCCAACATGGCTCGAC
CCCTCTTCAATCCTCTTCAATAGATGTCAATTTTGGGGGTAGCTGAATGCATGACTGTAAAAGAAAGCCTCATGCATGACACAATTTTGACTCCCCTGAT
TTGGATCGGCCTATACGCAATAAGCTCATCctcatattctgcaaagcaaaatttgtctTCAGCGGCTTTAAGTTTTTAGAGACCGACAACAAGCTCATGA
ACGGCGTCTAAATGCTTAAACACTGTTATAACCCCTTCATCTTGCGACTTTGTAGACGGCGTGATAACTCGGTGCGCTTACAATACGTGGTCCGATGGTA
AACACTCATTCAAAGTGCATAAAGACCGCATGTTGGTCGAGTGATGCAGCTTGATTCCTAAGACGATATTTGACACCGTCGAATCACCAAACTTACTTTC
GTTATCCCCTTTTCCTTAAGACGACCTGAATGGTCTGAATCATCGGCATGCGCACGTTAATTCCAGTAAAAAATGTCTCTTGATGGACTTCGGCTCGCTT
AGACGCCATCTTTGTGCGAGGTAGATCGACTGGGAGTGTTTTTGCTGCGGTGATCAACCTGTTTGTTTGTTGGTAAAGCAAAGAGCATGTTTAGTTCGCG
TCTTACTTCACTACCCATGTGCTACACTTGATCCAGCCAGATATAACCTGAGCTATGTAGACTAATAAATGTAAACTACTATGTATGCAATCAATATCCG
TAACGATGACACCATTCAGGCATTCTTGTGACGTCAAATCTCGTCTTTTCATGCATGCATCAGGTGGCGTCATCTCAACAATAGCATCAGTAAATAAGCA
GAGGATGTGACATTGAGTTCTGATAGCCTTAAATATTTTAGTCACTCATTAATTCAATACCCGCGCTGCTTCGTTTCCACAATTCCCTATTATTACAGTT
AGTATACCATGGTTGTATTTTTCTGCGGGCATCTTTTGAGTGATGAAGAATTACTCCTGCAAATGAACACCTCTTCTGTAAAGAGTTTTGCTCGTTGCTT
TCTACCAGCCGATATACTAGTATGTGCAAAGCTAAAATGGAACTACGCATCAATCCAACGAGCCATGATTCATTAAAACTTGCATCAACTCttaaacggg
gttacacgtacttgCATCTTGTGAACCTTTAACAAGAAACGCTGCGATGGTCAACCAGTTGCCTgttaacaggtgtgtgtcacacaaggtgtgcatggtg
tgactgcactcaaacaagaatacggtatgtggcgaggtagccagtagttatgcatgtatttagacttactattatatatttagtatatttaggaaaatct
aaacttttaaaattaggataaaaaatcaaacaaatatcaattttggattttaaatcgAAGAGTCAGTTAGCCTTGTGAAGGCAATCattattcttggagt
aagcggattgcgatccgctaactcactTGTacaaaacgaaaggtcggtgacctaaactacgcttcctcaagtgctaagctacggcagccccgctgcaacc
cTCATTAGAATAAGATACGCTACCTGCTGTCGGCTCGACGAATCGCTTTGGCTGCCGTGCCATGGCTCAACTGGCAAAAGTGTCAACTATCTCTGCCAAA
TGTTTTAGATATGCAATAAAAATATTGCTAAcacaaattttaaattttcagCTCTTGTAAAGTTTCGCGTAAAATTCCACATTGTATTATCGTAATTGCG
ATCTAATACAAAGTATGTGATACCGTCAATTAaataaatattcacaatatAAATATCTATACCACTACATCCCGTGAAACAGCCGCTAAAATAGAAAGTA
GCAATCATTTCTTTACACGCGTCTCATCGTCATCGCGATCTTCCATTGTTCCTCGAAATCATTCAACAGTCGGAGTTTCACGCAACACACGTTCCTATCA
GCCTTGACAGCTTTAATACAATGGTCGACGACACTGTTGCTACATCGCCAAACAaattggcgcagaagattTCAACTGCACAACTCACTGATGCCAAGAT
CACTGGCTTCCCCGAGTTTACGCCTGCGCATCGTTCTCTTATGGCTAAGCACTTATCCCGCGAAATGTATGGACAACTTAAGGAATTAAAAACCTCAACG
GGTTACACTTTAGATCGCGCGATTCAAACGGGAGTGGATAACCCTCACCTTGGTGTAGGTGTAACCGCTGGTGACGAAGAGTGTTACGAAGTGTTTAAGC
CATTATTTGATCCTGTGATTGAAGGCTGGCATGGGTACAAACCCCATGACAAGCATAAATGCGATATGGATCCATCTCACGTGACAAACGGCAAGTTACC
AGACGAATTTATCATTTCGACGCGTATTCGCGCTGGTCGTAACATTCGTGGGTTACCTTTACCGCCTGCCACATCACGCGCTCACCGAAAAGATGTGATG
AATCTATTGGAGTCTGCTTTGGGGGATATGACTGG