Description :
From Genome Similarity Track
Location :
Scaffold_140:24144- 25353
Sequence
1209 bases(100 bases per row)
TCCCGATGTCCCCTGCCTCCTGGTCGCATTTCTCCTCCTCCTTGCCTCCAGTCAACACGATCGTGTGGTAGAAGCCCGCAGCGACCATCGCGATGCGTTT
GCCAAGGAAATCTTCGATCGGAAACGGGAACAGCTTCTCGGTGGTGTCTCCCGTGCCCAGCTGGCCATGGTTGTTTCGCCCAAAGACGTACAGCATTCCA
CTATCAGAGACTGCGACTGTGTGGTAGCACCCGCATGCGAATCGGATGATCTCTTTGCATTCGAGCTCTTCAATCAGCTGTGGCGCAGCGAATCGCTGCT
GCTGGAGCTGGAGGTTTGCAGCTGGCGTGGCATTGGCTTTGCCAAGACCCAGCTGGCCGTAGTCGTTCCTGCCAAACCCAAAGAGATGAGCGCCACCGCA
GAGAACGATGCTGTGGTAGTACCCGCAGCGAATCTCGAGGCACACGTACTTCTCCAATCCGCTGCGCACCTGCACTGGCACGAGCTGGTTCTCGATCGAG
TCAACGCCCAGTTGACCGTAGTCGTTCTTCCCGAATCCGTACGCTTTCCCACTCGAGCTCACCACCATGGTGTGGTACTGACCGCACGCGACGGACACGA
TATTCTGCTCCGCCAGCGCCTCAATGAAGTGCGGCACCTTGCGGTCAATCATATCGTTGTGGCCGAGCTGACCGTAATCGTTGCGCCCGAACGTGTAGAC
GTGCTCTCTCCCTCCACCCGCTTCGTCGCACGTGAGGATCGTGTGGTAGTAGCTGCACGATACGATACGCACGATCTTCGCTTCGAGACTGCGCACGAGC
TTAGGGATGTTCTCGCTCGTCGTGTTGCCGTGGCCCAGTTGACCACGATAGTTGTAGCCAAACGTAGCTACTCGCCCTTCCTCCGTCACGATCACGCTGT
GCTCGCAGCCGTTGTACGCATGCACCTGGGCGATCGCGTACTCGCCAAACTTGTGGATCTCCGTGATGTTACCCACGCGATTCGTCGCCCCAACGCCGCA
CTGCCCGTTGTCGTTGTAGCCACAGGTGAATACCGTACCGTCGCCACACAGCACGATGCTGTGCTCATTGCCAGCGCTGACCTGGATCACGTCTTTCCGC
TGGAGCGCCTCGATGCGGTCGAACGACTTGCGTGTGATCGTGTCGCCGTGTCCGAGTTCTCCATACGAATTCTGTCCACAGCTCCAGACTTCCTTGTCGT
CGCAGTCGT