Description :
From Genome Similarity Track
Location :
Scaffold_23:24140- 26909
Transcript NameFunction/comments
Phyta_totarag1281hypothetical protein

Sequence
2769 bases(100 bases per row)
TATGCGGCGGTCGTTCCCAccctgctgcgctgctgcagccccACCGGACCGGAGATCGAGGTGCCTCTCGGCCGACGCCCCGGAACTCTCACGCAAAAAG
GTGACGAGCCTGAGACCGTCGTCGCCAATCGATCAGTCCGCTCCGTACCACATCGTTCACGGCACGCGGCGCGGCGATGATCACGTCCACTGATTAGTCA
AGAGCCTTGAAGCAAGCCTTGCGAGCCATGCATGCTGGCCGCGTCTGACGAGTAGGTCCCTTGATGCAAACAGCGGTTGCGTGGAGTGCGGGCTTGTCTT
GTCCTTCGTCGCCGACCGCCTGCCTCCCCACCATCTATCGGCAGTGCCAAGACTTGAGGCTCGCCTGCCCCGTCTCGTTGTAGCACAGTCATCGCCACGC
CCCGTTTTTATTTCTGCCGGCCGCTTCGTCAATACGTGCTGAACACGCGGCAAATCGGCGCCGGTAGCTCCGGTCCGGTGCTCAAACTTTGGCGTCTGGG
CGGAACTTGCGACTCCACTGACGAATGCACGAAAGCCCGGCGGGAGGATGGCAGCCAAGTGCTCGCTGTTACTGAATGGTCTTTGGTCGTGGCCGCGAGA
CTTTTGCACGTCGTTGCCcgtcacctgcagcagcagctggagggTCAGTCTGACCGTCATGCCGCAAgagtgcagcaacagcagcacaagcggCAGCTCT
AGCCGAGTCGTCGCAGCACTTCGGGTGATGCCCCGGTCATCATCGCCGCTTTCAGCAGGTTGTGTTGCAAGTATGGCTTACACGTACAGTATTGCCACGA
CGTTCTTACGGCCACGGATGCCGAGCGCCTGTGCCGCCGTTGAAGCGAACTTCAACCATGCGGCACAATGTAGCCGTCTTTTTCGGTTTTTCTCATCTAA
AAaatgtacagacaatcccctcagtaggcatagcgtcgggaaccAACTTACTGAATTTAGTACACTTAAAAGtacaagtattaatacatgtactttaTTA
TTCCTGGGATTtctatcgcggggtgtatTAATACCATTTACGTGGAACCGAGTagtgtaccatatatttggcacactcaatgcaaccattcgtgctgttg
gagatcgctcataacaaccagtcgtgctatcgattggctgagcttgtagctggtcagtcagtgagttgcaacggttgcagctggtggtgggtgttggtga
tccggacaagcaagatgcagaagacgagtacgaggaagagtttgctcctgaagagatcaagtatCAAATGGATCGGTAAGCTACTTATTCAGGTGGATGC
TAATGGAGTGTTGGACCGGTCAGTGGgcggactacgagtgatgcaacgcatGCTTCGGAGAGAATTAGGCACGAAACAAAgaatcaagcagcagatgtca
TTGCTAcagttcttcggacgccccGaacagttgtgactttcccatagttaagcacccTACAATAGGAATATTCGCCGATCTTgtattccttttcacaatt
gagaggtgacATGAGCTTTATTTTGCAggtcatcgggaaccgctttcatattcctgttgagcgggtatgacacttctggggattacaGTACACCCGAGGG
GGTTGTCTGGATTTTATAGGGCTCCTTTTAGGCGTTAAAAATTTGATACAAACTGTGTTCCGGAATGGTAAAGAGAATGTTTGTTTAATAGTAGCAATAT
TTAAATGAAACTGTGCTCTGAAATACGAAGGTCCATAAAATGGATACAATTAATTGATTACCTCGCGTTAGTGGCTAACTTCAGCGTCACAGAAGTGAGA
TCCCGATCCCACAATTTTGCTTATCAAACCACAGAGCGATTTGCAGCTTGTGCAATCCGTTCATGAGGAACGAGTTAGGCCGccgcgtgcagcaccaaaa
ctGAATGCggcagcaggcgctgcagcgccagctccaatTCGCTCAGTGCCGAACCATGCGGGTCCGTCATCTGGGCACCAGCTGACGTTGCGGTCGTCAC
TAAGAGCTCCAACGCTTCCAGCAAGGGCCGTGGGGAAGTCTCCGAGTTCATCGGGTCGAGTTGCAGTGGCAGTTTGGACCGGTTCGTGGGTGTCTGCACT
GCACCACCTGAACATGCTGAGGCTCGCTTCAACGCCGCCACAGCGCACCGATGGACCGATTGACTGCTGTGAGGCGAAGGCAGCAAGAGAGCCATGGCGA
GCCCCATCATGTGAGCGTTGGTGTCCGTGGCctcgacgctggacaagTACGTCGTCCTTTTCCAAACGCTCGAGTGGAAGGCCGAACTACAAGCCACAGG
CAGCAGTCGTACCCACGTGGCGCGTCGGTCAGggtcttgctgcagctcgcggagAATCCGAGGAGCTACACGCGCTCCCCACGCGTCGCTCGTAGCCTGC
GGACTGTGTccgtgcagaagctgcaacaGGAAGGCTGCCGTTCCgatctggacgagctggGTCGCGATGTCATCCAGGGCTCGGACTTGCGAAGAAGCAA
GCACAACGTCGGCACTTGAACCGCCACTCGTTGCCATGTCCATGAAGGCGAGGACGGCGTGCTCGGCTTCGATAGAAGACCGTAGCTTTAGTGTCTGCGC
CACCAAGAGATTAGCGATGGTCGAACACACAGACTCAACGCCTATAGATCCGACCAAAGCGACAAGGTTCCCCAGAGCTTCACAATCCGTGTAGTCGCGT
GGGTCCTGCTCTCCTGAAATCCCAGGGGCCAACACGAAGCAGCTTTTGCGCACAGAAGCTAGAACtgga