Description :
From Genome Similarity Track
Location :
Scaffold_8:241385- 250463
Transcript NameFunction/comments
Phyci_212089eukaryotic translation initiation factor 5B
Phyci_212015Hypothetical protein
Phyci_128331hypothetical protein PITG_20284

Sequence
9078 bases(100 bases per row)
GTGGAACCGGTTCTGTTCTCTTGTCCCCAGTATGGGCGGGTAGAATCGTGTGGGCCATTGATTGGCGAGCCTACGGGAAGCAGAACCGGAAATCCTCCGC
ACATCCACAGTCGAGCCGAGCCAAGATGGCGCCGAAGAAGGGGAAGAAGACCGCCAAGAAGGCCGCGGGCACGGCCGCCGCCTCGGACGACCTCGACGAC
CTGCTGAACGAGTTCGCGCCCGCCGAGGGCGCCACGCCGCAGCAGCAGGAGGCGGCGCAGGACCAGGCGACGCAGCAGCAGGAGGACAAGCCGTCGGACG
TGGACGCCGCCGCCGCCGCCGCGTACCTGGCGTCGCTGGGCGTGGCCCCCGCCGCCGGCGGAGagaagaaggacgacaagaagaagaagaagaagggcaa
gaagaagCCCAACGCCGACGCCAAGAAGGACGACGACAAGAAGCCCATGTCGGCCGCGGCCAAGGCGCTGATGGAGCGCCAGGCCGCGCTCAAGGCGGAG
CAGGAGCGCCTGGAGCAGGAGCGCCTGGAGCAGGAGCGCATCGCGCAGGAGGAGGAGGCCAAGCGCCTCGCCGAGATCGAGCGCGAGGAGGAGGCCCGCC
GCAAGAAGAAGGAGGCGCGCGCCGCCAAGATCGAGCGCCAGAAGAAGGAGGGCACGTACATGACCAAGGCCCAGAAGCAGAAGGCGGCCAAGGCCCAGGC
CGCCCTCGAGGCCATGCAGCAGGCGGGCATCGTGCCCACCGCCGGCGGCGAGAAGAAGAAGGTCGTGTACTCGGACAACAagaagaagaacaagaagaac
gacaagaaggacgagcccaagaaggagcaggtcaagaaggtggagcccaagaaggtggagaagcagcaggaggaagaggaggtggacgactgggaggcgg
ccgaggacgccgcccaggcacagcaggaggaggacgaggCCCCCGACGCCTGGGATGACGAGGACTGGGAGACCAGCGACGTCGTGGCCTCGCTGGAGGA
CAAGCTGCACGAGGTGAAGGAGGAAGCTGCCGCCGAGGAGAGCGACAGCGACGGAGACGAGGACCTGCTCGTGCTCGAGCAGAAGAAGGAGCAGGAGCGT
CTGCGCCAGCAGGGTATCGCGCTCAAGAAGCGCCAGGAGGAGCAGGCCGAGCAGATGCGCCAGGAGGCGGAGGAGGAGCGCCAGCGCTCCAAGGCCAAGA
TGGAGGCGGAGCGCAAGAAGAAGGAGGCCGCTGAGCGTCGTCGCGAGCGCGAGGCCGCGGCGCGCGCCAACGTGTCCCTGGACAACCTCCGTTCGCCCAT
TTGCTGTATCATGGGTCACGTCGATACCGGTAAGACCAAACTGCTTGACAACATCCGTAAAACCAAGGTGCAGGACGCAGAGGCTGGTGGTATTACCCAG
CAGATTGGTGCGACCTTCTTCCCCGTGGAGGCCATCAAGCAGAAGACGGCGCGTCTCGCCGAGACGATGAAGCTCGACTACCGCCTGCCCGGTTTGCTTG
TGATTGATACGCCTGGTCACGAGTCTTTCACGAACTTGCGTTCGCGTGGTTCGTCGCTGTGTGATATCGCCATTCTGGTGGTTGATATCATGCACGGTCT
GGAACCGCAGACGTTGGAGTCGCTGCGCCTGCTGCGTCAGAAGAAGGCCCCGTTCGTGGTGGCGCTGAACAAGATCGATCGTTGCTACGGCTGGAAGACG
ATGCCCGATATGCCCGTCCAGGAGGCCCTCAAGCACCAGAACGAGCACGTCATTCGCGAGTTCGAGGACCGCATGAAGTCGATTATCGTCGAGTTTGCCG
AGCAGAAGCTGAACGCCGAGGTGTACTGGCGCAACAAGGACCTAGCGCACACGGTCTCGCTCATTCCTACCAGTGCTATCTCGGGCGAGGGTGTCCCCGA
TCTGCTTATGATGTTGACGCGCTTGACGCAGGAGCGCATGGCGAAGTCGCTGGCTTTCGTGGATATTCTGCAGTGTACCGTGCTTGAGGTGAAGGTTATC
GAGGGTCTCGGTACCACAATCGATACGATTCTGGTGAATGGTACACTGGAAGAAGGATCGACTATCGTCGTGTGTACATTAGACGGACCTGTTGTGACGA
CGATCCGTTCGTTGCTGACCCCGCACCCCATGAAGGAAATTCGTGTGAAGGGCGAGTACCTCCACCACCAGAAGATGAAGGCCGCTATGGGTGTCAAGAT
TTGCGCGCAGGGGCTTGAGAAGGCCGTCGCTGGTACGCAGATTTACGTGGTTGGCCCTGACGACGACGTTGAGGAGCTCAAGGACTCGGTTATGTCCGAC
CTGACGGGCATCCTGGACTCGGTGAAGGCCACCCGCCGCGGTGTGATGGTGCAAGCTTCGACCCTGGGTGCGCTTGAGGCCCTGCTGGAGTTCTTGCGTA
CGTGTGACCCGCCCATTCCGGTCTCGTGCGTAAACATCGGACCCGTGCACAAGAAGGATGTTATGCGTGCCTCAGTGCAGCTGGAGCACCAGCCCGAGTT
CGCCACCATCCTGGCGTTCGACGTGAAGGTTCACAGCGACGCCACGGAGCTGGCCTCGGAACTCGGCGTGCGCATTTTCACGGCTGACATTATCTACCAC
CTGTTCGACCAGTTCACGGCGTACATGGACAACTTCCGCCAGGCGCGTCGCGAGGAGTTCGCGGAGGTTGCCGTGTTCCCGTGCGTGCTGAAGATCCTGC
CCAACTGCGTGTTCAACAAGAAGGACCCGATCATTCTTGGCGTGGACGTGGAAGAGGGCATCCTGAAGGTGGGCACGCCGCTCGTGGTGCCGTCCGCGGG
CGGCTTCCTGGTGGGCAAGGTGGGCTCCATCGAGCGCGAGCACAAGGAGGTGGACCGCGCCAAGAAGGGCGCGTCCGTGGCCGTGCGGATAGACAACGAG
GGCAGCGTCATGTACGGCCGCCACTTCGACCACAAGAACAAGCTCGTGTCGCGCCTGACGCGCCAGAGCATCGACGCGCTGAAGGAGAATTTCAGGGAAG
ACCTGCAGAAGGAGGACTGGCAGCTCGTCATCAAGCTCAAGAAGGTGTTCGATATCATTTAGACGTCGCGGCGAACGTTCGCGGCCAGAGGGTGTCAAGA
GGACTCGGCCTGCGGGTCCTCTTGAGATCAGTAGGTGTTGCCAGCGGCGGCAGTTAGCGGTTCTAGCAATATATGATGTTTGCTTTTCGTCGACATGCGA
GAGCTCCGGCTAGGAGTCAGCGGAGTTCAGCGCAGCGGTGACATCGCGCGCGCGCAGGCAGCTCGAGCTCCGATCGCATCGCGCACGACACCGCTGCGTC
CTAGGTGAAATCAGCTCCGCCTTGGCGCACCGGAGGCAGCGCGTCGCCGCGGTGCAGCACCAGCGAGGCTGCGGCGCCGTTACCAATAGCCCCGCGCGCC
GGAGCCCCGTCACGGTGTCTCCCAGCTGTCTGCGCACCCTTGCAATGGTGCCGCCGCCGGGATTTTCTGCGTGTGCGACCAGGCCACCGAGTAGAAGACG
CAGGCTTCACGCGCGCCGCGTCACGAGGGCGACGGCAGTGCTCAGCGCCGAGATGATCGCGCTGAGCGGAGCTGGAGCCATGCATGCACGGCAGGAAAGC
AGGTAGGCAGGAGCGTCTTGCCAGTGGCGTCCACGTTTCAGCCGCTTGGTGACGAGGCCCTCAGCTGGACGGCGAGACCCTCAAGACGCCCACGAGCGCC
TGAATCTGGCACGCAGCAGCTCCAGCGCCGCGAGCTGGTCGGTCGCAGCATTGCAGACGTCGGCATAGACCACCGACCGCGGGCCCTATACCAGTCGCGT
GCTGGTGCTGGCGAGCAGGCACCGCGTCCCGGCGCGCCTGGAAGCTGCAGGACGATAGATAACCCCTCCCAACGCTGCTGCCGTCCACGGCACCGCGCGA
CTCGGAAGGGCTGGATTTTGCCTGCGCGGCGTTTAACGGAGACTTCGGCGGCGTTGAAGTTGACCGGCTGGAGGATTCGCTGGCCAGCGCGCGGCGGATC
TGGCCAGGAGGGACAGCCCAAATGCGCGACGTGCGCCAGCGTGTCCGGCCCCAAGCGCGGGCGGAGGACGATGCGGCCCAGCTGAACGCGGGGAACCGCG
GCGCTGGCGCGAAGCAACGTGCTACTTGGAACGTCGCCGCACGTGGCTGTGTGCATGTTGGGGGCGGCGCTTCTGGTGGTGGCGAGATGGAGACCGGCCC
CACTGAAAGCGGGACCGAACGGCGGGATGCAAGCCGCGGCGGGCGGGCGCGACCTCACTTCGCAATTGGATCTCGTCCGAGCAGCTAGCTAGCGATACCC
TTCCGTTCTACCGTTCTACCGTTCTACCCTCCGCAGCGACCATGATGCACCGCGTGCGCATGCCCCCCATGCAGCAGCCGCCGCTCGGCCTGCTCCCGGA
GCGCGGCCTGGTCGGGCCCGTGGCCGCGGCCAAGGCCAGCTCGCTGCGCGCCATGCGCGTGCCCAAGTTCCTGCGCAGCCTGTACGACATCCTGCACTAC
GAGGACCAGGCCATCCTCACGTGGTCCAAGgacggcacgtacttccagatcttcgacaccaagcgcctcgaggtggcggtgctgcccaagtacttcaagc
acggcaagttcactagcttccagcgccagctcaacaacttcggcttccgcaagtggaccaagACGCAGTCCAGCGTCTGCACCTTCAGCCACCACCACCT
CGTGCGCTGCCACCCGCAGCAGCTCGCAGACTTCATCAGTCGCCGGCCGCCGGCCAACGGCGTGCGCGCGGCCGGCGCGTCCTCTGGAGCGCGACGCAAG
CGGACGTTCACGGAGCTGATGCGACCTGCAGACCACGCCACCTCTGCTGCTGCCAAGTCGAGCAAGCACGACAGCGACTGCTACCGCCGTCTCGAGAGCA
GCGCGGCCGAGGACGCCGTTCCAGCCAGGTGTGCACCGCGGTGGGTGACGGACCCCGTGGGCTTCCTGAAGGCCGGCGAGGACTGCAACGGCACCCCCAC
CAGCACGTCGTCCGAGCAGGCCTTCAACTTCTCCGTGGAAGAGCTGCACGACATCATCCTCCCCGTTGCGCCCGTGTCGGAGCGTCACGACAGCCGCTCC
ATGGAGAAGATGTTCGAGCTGCGGATGTTGAACGAGTGCTTGGACTTCGGCCCAGCGGGCACGTTGTACGCCGCCGCAAGCCAGAACGGTGGAGGAGCGC
TGTACCCTTCGTCCCCGTACGCTTGGGACAGCGACTCGTTTTTCGCTCCTGTCGGCCGTACGCACTTCGAGCAGGAGCGCGGGCAGTGGAGATTACACTG
AGTGAAGCGTATCTGGTTATTAGACATCAGGGGATCAACCCTCAAATACGACGGTGTTGTTGTTGTTATTCATCATCATCACATGCCCACCAACGTCCAT
ACTAATGTCACAGGTGTCCATCCAGCAAAGCGCCGTCTTCTATACATCGGAGAGCTGCCACAACTCCAGCATCGGTAATACTGAAGGGGTTAATACGAAG
TGCCGTAGCAGCCTTTTTGCTGTCGGTCAGCTAGTGAGGTCGCGAGTTTGACCCTCCCATGCGGTCGCGGTGGTATCCTTCGTTTTGATACCCACGGCCT
CCGTAGCGACTGAAGTCCTCAGGATGCATGTGTCGCCTGCGACCATTATTGCCATGATCCCCAGGGCCGAAAGTCCGTGGACGACGGCCTTCCTTAGCAT
TCCAGTCCTCACCACGGGGGCCCCTGGGCCGTGAGCGCGATCTCGATCGTCTTCTATCGAAGCCACGGTTTCCCCTTGAACGCTCGTGCGGGCCTGCAGG
AAAACTTTCTCGGTCTTGGTAGGGTGCTTGCATGTTGCGAGGGTGCTGCCACCGGGGTGGAGACCTGCCCCGCTGAAATTCTTCTCTTCTATCGTCCTTG
TCAGCCGTAGTGCTGCTTTCTATTTCACCTTCTTCCTGCCCTTTGTCGCCCTCCGCAGTCTTCTGGTCACGTGGCAACGTCGGAACTACCGTCTCCTTCA
GCACGACAGTGCCAGCGTCGCCTCTCATGGCATCACTACGTCCAGCAACTTTTTCCGCAATAGAGCTTTCGCGACCACTTTTTACGAACTCTTCCTCCTG
CCGATTCGTACTTGACAGTGATGATTTGCCAGTGCTCGCCACTATTGACACCGCAACGGCCCCAACACGGGGTTCTTCGGTCCCCAACTCGTGTCGCTGG
CCATGGAATGATTTCGATCTCGATCTCGATCTTGATCTACGCTCCACCAATGCACGTGGTCGTTTACTCCCACTTGTAGATGGACCGTACCGATTGTCTC
CTGCGGACCTTTGCGATGGGGCTCCTCGATCAAATCTGGAGTACCGGTGATCGCTTCGTGGTGTCCGCTGGCGCTCTCGTCGCCAAGATGGAGTACTACG
CGCACTCCCAGCCTGTGACGACACTGGAGACGACTCTGGGGCACACTGTTCGACCGATCCTGACCGCCGCGACCAATCCTGAGACTCAATTCTGGCGGCG
GGGGAAGAGCTGCGGCTTATCATCACACCCGCTTTGTATTCAAGCCGAAGCTCCAAAGGATTTCCGAGGTCATCACGAAATATATGCGAAGCCTGCTCAG
CGTCCTCTCGATTGTAATAATGCAAGTAGACGGTACCCGGCTGATTCCGCATAAGTTTCTGCCAATTTTCGCGCGGGATATCGCAGCGCGGTACCGATTT
CTTAAAGGTGTAGCGCTTGCTTAACACAGCCGCAAATTCATCTCGATCTCGATCTTGATTGAAGCGAATGCCTGTAGATTTGCGCTCGAAGCGCGCACTG
CGGATGATGAGCGTTGTCCACCCGCGTAGACGCTGAGGCACAAAGGTTGTGCCATACATACGTTTTTGATAAAACTCTCTGTCTTCCGGTCGCTCAAATC
GCAGCTCCTCGTAGCAGTTCATTCGTTTTGCTTCACACTGGCCATCGTCAGAATTATCAGGGGCGGGACTGGACTCCCCTTTTGCCTTCGGCGCAGAGAG
AGACACGCCGAAAAATACTGCAGGGTAGGTGTCTCGCTTGGAAGCCATTTCTCGTTTTGTCGGGCAGCTCAAACGAGGAACCAGATCGGACATAGCTTTC
CCATCAATGTCAAACACTTCATACCCCGTCATTCGAACTGGAGCCTTCCTAGGACTTGCGGTAGCAGAGTGGCCAAGAGCTGATAATTCCGCAGCAGCCA
AGAAGATAGAGTTACGCTTCCGAGCTAGACGCATGAGTGCTCGGTCCTCTGATGCAATGGTCGATTTCTTCACTGGCACGCAATTTTTTGTTCGCTTCCG
CTGAAGCTGCGTAGGAGGCTGGCTGGAAAACGTCGGACTTGGCTCAGGTGAGGGCGAGGGTAGAGGCTTGATAATAACAGGGATTGAGCCACCTCGAGGC
TTGCCATCGCTGAATGGGCCTGATAGCCCGGAACCAGTCTTGACAGATCGTTTCGGAATTACAAAGTCGGCGGCACTGGGAGCAGCTTTGACCTTTTCTG
CAATTGACTTCCTCGGTATCGGCATCATGTCCAGGAGGATATTTTGCTTTGCTGTCTCCTCGGTCTTGTTTTTGCTTTCGTCATCTCTGTCTTTTGAAGC
ATCTTCTTCCTTTCCTTGTATTGACTTCTTCGGAATAGGCATCATGTCCAAAAGAATATCTTGCTTAGTCGTTTCCACGGCCTCTTGATTGGTCGTCTCG
GCAGTCTTGCTCTTGTTTTCGGCACCTCTGTCATCCGTTTCCGAAACGACGTTCTGGCCCACGCCATTCTTGACTGCAGCATCTACTGCGTCAGAACGCG
GCAGCCCGGGTGGGCTGGGATCACGTTTATCGTCTACTGGCCCATCAGACTCAACGACATCCTTAAAGCCAGCAGCGCGTAATGCACTCGCATGAtcccc
ctctttttccacctttccctccttgccctccttgtccttgtccttgatcaccttgtcctcttcggccaccacgtcgtccttgatcaccttttcatcctcG
GTCACCACAACCTCCTTGGTCACCACATCCTCCTTGGTCAACACGTCCTCCTTCGTCTCGTCTTTAACCACTTTAtcctccttggtcacctcatcctcct
tgggcgcctctttaaccgctttagcctctttgttcaccttctcctccttgttcagctccagctccttggcaactttgtccttcttggtcacctcgtcctc
cttatttgcatttttatcctccttgttcaccttctccttgttcagctccagctccttggcagccttgctcttcttagtcactttctgttccttggcagcc
ttgtctttcttggccaccttttccttggtaacctcatcttccttatttgcattctccttgtccaccttcgcgctcttccccgtcttctccttcttcgcct
CGCGCTTCAGCTTCACCGCACTCAACCTATCATGCTCGCCCGTCGCCAGCCGACGAGCATGCAGCTTGTGCATCCGCTGTTGGCGGAAGGCCGCCGCCTT
GCTTTTGGCCGAGTCGGCAGCCGTCTCGGACGACGCCTGATGCTCCTCCTTCTTCAGCAGACCGCGCGGGGCCACGTGGCCCGCCTTGTCTGGCTGCCGA
CGTCCGCGCTCTGCGTCTTCACGCTCGGCAGCGACAGTTCTCTTCCTCTTCCCCGCCACGACGACGCGCCGGCTCTTGACCTTCTTGTGAGAGGGTCTGG
TCACGtcctcctcttgttcttcgccttcttcttcttctcggcgacgcttcagcctcttcttcttctgtacagggctgtgcttcttatcgttctctttaac
atctttctcctctttcttctcctccttatgtggcttctgctcgtccttctCGTCGGTCACTTCGTGCGACGCCTTGGCCAGCAGCGCAGGGGCCTTCGCG
CGCGGCGTTCTGGCCGGCTTCTTCTGGGGCGTGGCATGCGGGGTGGCGTCGGACGAGTCGTCGTCGTCGTCCAGGGCCGCCGTGAGCTTCTTGAGCCACT
GGAGCTTCACGCGAGGCTTCTCGGCCGTCGCCTCCGCCGCCATCGCCATGAAGAGACTGGGGTCTGGTGGTAAAACGG