Description :
From Genome Similarity Track
Location :
scaffold_49:24135- 25601
Transcript NameFunction/comments
g4351.t1 hypothetical protein PHYSODRAFT_481033
g4352.t1 hypothetical protein PHYSODRAFT_349597

Sequence
1466 bases(100 bases per row)
CGTAGCTCTTCATGTGGTACTTGAAGCAGTGCGTCCAGACGCTGCAGGCCTTGGCCGACACGGCCTTGAAGCGCTCTTCCTCGGGCATGTAGAACCGCTG
ACTGTCTCCAGGCAGCAGCAAGCTGCTCACGCGCCGGGCCATCGAGTCCGACGCCTCCTTGTGGAGCTCCTTGTCCTGCAGGTATCCCAGAGCCACGAAG
CTGCGGTCCGCGCGACTCGTGAGCGTCACGTGCGTGAGCACCAGGCGGCGCAGCAATTTGCCGTTCACTGTGTCGTCGTCCGAGAACACAAACAACGCCG
CCTGCTGCGCCTTGAACACGCAGAAGCGGCGGCGGTAGCGGCGGAAGATCCCGCGCCCTTCGCGACGCCACAGCCAGCCGCTGAGCCGCACGGGCAGCGC
CAGCGCGCGCTCCGGAGCCTGCACCGCCGGGTGTTGCTCCTCTAGGTACTCGTAGATGCCCTGCTCGGCGTCGCGCACGCTGCGCACGGCCACGGCCGCG
CCGATGGTGACGTTGTCTGCCATCAGCTCTCGAGTATAAGGCCCAGTTGCGAGTGACACCAGTGGCATTCTTTCGGGGGTATTAGTGGCACTCTTTCGGG
GATCCTTGGTTCTGGGATATGCCGGGGTCGAGGCTAGAATCCAGACGCCTCGCACACGTAGGGGAACCGAGTAGAACGCAGTTTGCCTGCCGCCATGGTG
CTGTCGGCTGTCTTCATCACCGACCTCAAGGGCAAGGTCATCATCTCGCGCAACTACCGCGGGGACATCCCCATGTCGGCATCGGCCAAGTTCACGCGCT
ACGTGCAGGACAGGGACGACTCGGAGCAGCGCCCAGTCTTCACGGAGGACGGCTACACATTCGTGTATCTCAAGGCATGGGGACTATAATTTGGTCCCGC
GCAGATGTGTATACACTGTATACTTACTCTCTCTCTCTATGATGTGTACACAGCACAATAACCTGTACCTGATGACCGTAACCAAGGTGAACTCGAACGT
GGCGCTCATGCTCATGTACCTCACGCGGATCTGCCAAGTGTTCCGGGACTATTTCGGAGAGTTGGAGGAGGAGAGCATCCGAGACAACTTTGTCATCATC
TTTGAGCTGCTGGACGAGACCATGGACCACGGGTACCCGCAGACCACAGAGGCGCGTATCCTGCGCGAGTACATCACCCAGGAGGGCCACCGCCTGGAGG
CGGCTCCACGGCCGCCCACGGCGCTCACGAACGCTGTCTCGTGGCGCAGCGAGGGCATCAAGCACCGCAAGAACGAGATCTTCTTGGACGTGGTGGAGAA
GCTCAACCTGCTCGTCTCGAGCAACGGCACCGTGCTGCACTCGGAGATCATTGGTGCCGTCAAGATGAAGAGCTTTCTGTCGGGAATGCCCGAGCTCAAG
CTCGGACTGAACGATAAAGCGCTGTTTGAAGCCACCGGCCGGTCCTCCAGCAAGGGCAAGGCTGTG