Description :
From Genome Similarity Track
Location :
Scaffold_34:241326- 242458
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12832hypothetical protein

Sequence
1132 bases(100 bases per row)
AGTCCGGGTCGACCATACAGTCACCCAATGCTATACAGCAACCTTTGACTATACAGTCTGAGTTCCCAATACAGAAACTCTCCACCGAGACGTCGCTTTC
CGCTACCAAAGACAGCACGTTGATGGCCCTTAAGCTCGTACGACCGGCTGTATCAAGCGAGGTCGCGGCCAGAGCACACGATAATGCGAGCCAGCGCCGT
GATCTTCTCCGAGAACTACAAACAGCAACAATGGCTGAGGTTTTCTCGAGGTTTGACGTCACACCGCCTGCAAGTAATTGCCCCACGTCACAGGAAGGAG
CGACTGGCACGGAGTTCTTACTTAACAAGCTCCTCCAGCAAGCGTTGTCAGATCTCGCACGTCGGTCGGCCTTATCGCCGTCCGAATTTGTGGAGCTGGT
TCGAGGGCAAACTATGAGTGATTACCGGCCAAACAAGAACATGGTGCCGACTGTCTTGGAAAATGTGTGCAAGGGCTACAGCCATTTGGATCTGCTCCAG
AGAATTGTTCAGTAAGGTGTCGAAGTTAAGCTGAAAATGTCTCCGCCTCGTCAGTCTGTTCGTCCCCCAAATCATGGATCTACACGTGATCGGCTCAACA
TCTTGCGCAAGAACATCCGAAAGGAGCAAGAAGCTTGGAGATGCCTGGTCTTGGACGCAGATCTTTTGGAGCAGTGGCCGGAAATCATCATCAGCCCCTT
CGGTGTCGTCGACAAAGGCGGTGAAGACTCTAAGGTGTGTGGTCGAACAATCCATGACCTGTCTTGTCCGGAAGGCGCGTCCACCAATGACTTCTCAGAC
CAGGACAGCATCAACAAGCCCGACTACACCCACTGCGATGCAGTGTCTCGCAAGATTCTGAGGGCCAAACAGCAATTTCCAAGCGCAAAAATAGCTGTGA
TGGCCGGTGACGTCGCGACGGCTTTCCGAAATATCAGCATTCACAGCAACAGTGTCTACTTGTTCGCCGGTAGGATTGAGGAAGAGGGCGCGATAGTTAT
CGAACTTTCCGCTCCTTTCGGCTGGACGGGGTCGCCGGGTTTTTACGAGATTTTTGGCGGGGCAATCACCCACGTTCACGGCTCCCACACGAACGCGTTC
TCCCCAAAAGGTTTCTTTGCCTACCACTGGGT