Description :
From Genome Similarity Track
Location :
Scaffold_11:24130- 42405
Transcript NameFunction/comments
Phymu_g836conserved hypothetical protein
Phymu_g837hypothetical protein
Phymu_g838conserved hypothetical protein
Phymu_g839conserved hypothetical protein
Phymu_g840elongation factor P, putative
Phymu_g841hypothetical protein PHYSODRAFT_554382
Phymu_g842U4/U6.U5 tri-snRNP-associated protein, putative
Phymu_g843pyruvate dehydrogenase E1 component subunit alpha
Phymu_g844hypothetical protein PHYSODRAFT_554387

Sequence
18275 bases(100 bases per row)
CCGCAACGTTCTCCTGTTCGACAGACTCACCAGCCGATGCCAAGAGTATTCAGCTTCCCCCCACTATCTGGACTGCTAATTGACCGCGAaactcgtgctg
ctgcctctgcacATAAATCCTGGGACGAAGCGCACAAGATTGAGGTCCTTATCGGAAGCAAGTGTGTCGGGCGAGTGAGCGCTGCCTCGAGAAATATCCC
ACCATCGATCCGCTCACGCCTGCAAGCCTCTGCAAACGTGTCAGTGCGACGAGAACGGTTATACGATTTGCTTCGGCGAGAttacgagcagctcagcaag
cGCATAACGCAGTGAACACTTTGAGAGAAGGTTGGTCACAATCGGCGACTGGAACACTTGGGCAGAGTTGAGAGAAGGTTGGTCATTGCATTGGAAAGAA
CGCATCATCTGTCAGCCCTTCGAAGATATTTACGTTGCTCTCACCATACAAATTTGTGTCTGGCAAAATGCCCATGGACCCCGCTTCTGtttgctgtggc
tgttggAACGACTGAGGGGCGggctggaactgctgcgttGGCAACGACTGCGGCATCATGTTTGGCGCTGACGACGTTGGCATCCCACCGTATCCGAAAT
TGTTTGGCATCATCGAAGCTCCTTGCGCTCCAAAATTTCCTCCATTCATGGCCATcatttgctgttgctgcatggGCATATTTGGCATTCCAGTCATGGG
GAACCCTGTGGACCCGAAACTTGCATCTGGATATCCGAGCGGCGTCATAAATGGGTCCACGGGAAAGTTGTTACTGCTACTATTGTTGTTGCCGCTTCCA
CTGCTAGCGTTGTTCGCTGACGTTGCCGTTGAAGACATGCCGTAGTTACTGTTGCCGTACATGTTGGggccagaagcagcaagatTCATCGGCATTGGCA
TCGGCATaaattgttgctgctggggcaTCATGCCTCCTCCCATCATGTAGTTCTGCGGGTTCATAAATGCagcggaggagctggcgggGCCACTGGTGGA
AGCCATGTACGCGTTGGGCGTGAACGTTTGCACCCCGGAACTCATCGCGTATCCTTGGGTTGATGTCGTAACTCCAGAGACAGCCATTGAAGAGGTTGAA
GTGAATCCACTCGATGTCTGCATTGGGTTCATCTGCCCAGTCGGGAAGAACATacttgagctcgtcgacgcGAAGCCAACTGTAGGCATCGGAGGCTCCG
GGAACATCGTAGGTGCCGCCATATTCGGAATTGCCCTAGATGCTGAAGTCGATGCCGTTGATACAGGTACCGATCCCATTgaggacgacgtcgtcatggc
CATGGGGTTGCTGCTAGCCATCGTCGAGACCTGAGGTGGCGCGAAAACCTGTTGTGAGGCAGCggtcacctgctgctgtggggcCTGAACCTGGGAAACG
GCTGCATTTGGCACTGCTAGCATCGAGTTCTGGGAAGTTGCAGCTCGTCTTGCCGCCGCTGCATTGGGCGATACCCGTTGGCCCCCAGTTTTATCGTCCT
CCTGAGCGATCTGCTTGTCCGCCAGCGAggccaacagctcgagcctGGCGCCAATCTGCTGCCGAAAGATCAGGCACCTCCGTACCCACTCCTTGTGCTC
TGCAGGACTTGTCTTGGCCGCTACAACAGGAACAACATTAAATTTAATGAATAACGTCGATATTCCGGTGTTCGACATTGTGATTTAACATACGCTGCTG
CTTATGGAGTGAGTTCCAGCCCTTCAGCGccatctcgttcttctccagcatggcCTGAATCTCTCGCTGCGAGACGGAACGTCCTGGTAGCAGCGCCTGT
TATGAATAATTTAAAGTTCGTTATTATCCAGCTGCTAATAGAATTCTGTTTATTTTTTCACGTACCTGCGCCGCAGCCGCCGCGCGCTGTTGCAGTGGAT
TGACGTGCTCCCTGTTTGTCATACATAGAGCGCGTGAGAGGCTGACGAGTGCTGAGGGCGAAGGGCGGGACCACGTACGACGCCGAGGACGCCATGGCCG
GTGGAGTGCACGAGTCGGATAATGCGGTAGAATTCAAAACGTAAGAATTAGCCCGTTATTAAGGGTTCGGAATAAAATGTAAAATTAGCCAATCCGATCG
TTTTACTTAATGATGAGCCAATGGGAAGACATACACATTTCTTCCTTTATGACAAGCTGAAGTAATTGGTCCGTCCATGATAAATCTGCGCCCCACGCGT
GTATCTGCGCCTGGCAAAGTGCTGCTTGTAGGCGGGTatgtggtgctggatgaaaAGTATTCGGGACTTGTTCTATCCAGTACCGCGAGGTTTTACTCCC
AAGTGGAATCCAAGGTAATTTTGACGTAAAAATGGATGTGATGAATAGCTCCTAATACTTTGTGAAAATTGTGACAGGCTAGCAATGAGGAATACGTAGC
TTCTGATAGTGCAGGTAGATGGCACGGGATGTTCCCTCTAACGGTGGAGAGCAAGCAGTTTAGTCAGCTTATTGACGGCTGGATCGAGGAAAGTGACGGG
AGATTCCGGTTCAGGCTCAGGTATTTTTTTCATCTTTATTATTTGACAATGTTTTGGCTAATTCCTGCGTAAATCTGGTTGTTCGTAGTGAGCATTCGCA
CCGCAATTCTTACATTGAGGAGACGATATTGTGCTCGATGAACGGGATTGCAGGGCTGGAAAGTTTCCAGAGGAATAATACCTTCCACGAGCTGAACAGC
ACGAAAGCGGGCGTTCAAGTCACGTTGAGTGGTGACAACGACTTCTACTCGCAAGTGCAGAGGGTTtgtatattttgttttgccATTGAGACCCGGATCC
GTGTCATGCTGACCAAATCTCTTGCCTTCTTTGATTAGTTGCAAGACGCCAATTTGCCTCTTCGACGCGCCAACTTGAAGACACTTGAACCTTTTCTTCC
TCCCACCATGGAAGGTAGGATTGGCATTTAGCTGTTCATTGGTTGTGGTACTGACAGTGCCTGTGTAGAGCGTGACGGAAAGAAAGTTGCATTGAAGACA
GGCATGGGGAGCTCTGCTGCACTTGTGACGTCACTGGTTGCAGCCCTCGTTGCATTCTTTGTACCAACGATGGAGTTCGATAAGGAGCAAAGGGACCTCG
AGCTGGTCCATAATCTTGCCCAGTTGAGTCATTGCTACGTGCAGCGCAAGGTATCCCCTGTTTCCTCGTTTTCGCGAGGTAAAATACCTTGGCTGACCGA
CAAAATGTTGCGTGCGCTGTATAACAGATCGGGAGCGGCTTTGATgtttcagcagcttgcttCGGTTCACAGCGGTATACGCGTTTCCCAGCGTCAATTT
TGAACTCATTCACGCTCGAAGATGCGTTGAAACCGAACGAGATTGCGAAATGCATTGAAGATCGAGCGTTGTGGAGCACTTCCAGTCGTGTGGTAGTGCA
TACTGCTAAACGATTTTCGGGTGGCTTGAGCGTGATAGTTCTAATTGTCGTTTGTTGAATTCACTGGTAGAAATCTGTTCGGCTGCCTTCCAGCTTTCGC
TTGATGATGGGAGACGTATCGTCAGGCTCGGCGACTGTGTCAATGGTTCGTCAAGTAATGAAGTGGCAAAAGGACCAGCCTGAGCATGCAAAGCAAGTGA
TGGATGCAATCCACCGCCAGAATTTGGAGGTTGAGCGAGGGTTTGCTGAAATTAGCGAACTGGAAGCTAGCACGCCTGTTGACTGGGAAGCGATGGCTGT
TCAAAGTCGCGAGCAGGTAAATTGCTAACGTTAGACTTTTTTTCTACGTGATCAGCTACACTCACAAATATTTTATACTTTTTTGCGCAGTGGAGCACCA
CGGACGCCAGGGTTGGAGCAGTTCTTCTGAAAATTCATGAAGCCTTTGCTCGTTTTCGATACTTCATGCGGTATGTACAATTAGCTCTGGTTGCAGATGG
ATCCTTCACTACAGTAGCTAATTTCATTTTTGCAATGGTGAAATCGTAGCGAAATGGGAACTTGTGCTGGGGTCCCTATTGAACCACCCGAGCAAACGGC
AATCCTCGATGCAACCTTGGCGATCCCTGGTGTCCTTCTGGCTGGAGTACCCGGAGGTAAAGAAGTATTCGATATTGTGGCTAGTTTGTAgactgttttt
ttttttttctaacCAGAGAACTGTCGATGCATTTAGCGGGTGGATATGATGCGATTTGTGTGGTGGTGATCCATGAGCGCTCTTTCCAAGCAGTTGAAGA
CTTGTGGGTTGATTGGCCAAAGATCCACCTCGACTCCATGTACGTCTGTACACAAGTGTGTAGCCATTTACTGCATTGATGACCATTTCGTTTTTGCATT
TCAGTATTTGTCCGTTGCTGTGTGATATTGATCGTGGCCTGACGGGGGTATCATCTGTGAAGTCCGGACTTCAATTTCACTCTGCCGAATAGGTTCGTAA
GGCAGGCACTCTAATGCTTGCTTTTATGATAGAGTACACGCACAAAACCAAAATCTCAAATCTCTGTCAAGGGTCACAAACCGACTTACTGCGTAGTATG
TCGAAGCGGAAGATACGCGACGAGGACGTGTTTGATGAAGATAACCTACATGTAGGGAAGGCTGGCTACGTGCCGCGCAACACTGAAAAGGTTGCTCGTG
TGGATACTGTAGAGCAAGAACACCTTGATCGCTTTTTAATTCCAGGCCTACGGTTTGCGACGGAGTCGTGGGCTGGGATGAAGACTAGCAACGAAGATCG
ACACGTTTCCTCGACCGAATTCTTCCCAGGCCCAGTATTTGGCATTTTCGATGGACACGGCGGGACATTTTCAGCAAATTTTTTGTCCCAACATCTTCTA
ACGACGGTCGTCTCAGTAATACAGCAGAATATCGGAGTTCAAGCCCTCGCTGAGCTTCACAGCTCCCAGGAGCTGTTCATTCGAGAGGAAGCGCGTAAGA
ATGCGATActggagcagttgcagctgctgcaccagcaacttgcGGAACTGGAATCCGTGGAATTGGTCTCAGACGCTGCCGACAAACAAGTGCTGGGTGG
CCAACTCAATGATGCGATCTCGCAGATGGACAATGAAGTTGAACAAATTGGCGCcgagcaagcagcacgtcgagaagagcgacgagatTGGTGTCATGGA
CAGCACCGTTGCTTCTTGAAATCTTTCAAAGAAGCTTTCGAACGGGTTGATGCGCAAATCCTGCAGAAAAACCCGTCGCAGGACGGCTCGACAGCTCTCT
TGGTCTGGTTCTTGGCTGATATTGACAGCAATGGTGATGGAAGTGACAGAGGAGCGTTGAGCTTCTATACAGTGAACGTCGGTGACTGCCGTGTCGTTCT
GTGCAGTGGCGGACGAGGTGTAGCGCTCACAAGAGACCACAAACCGGATCGTCGAGACGAAACCCAGCGGATCGAAAAAGCTGGAGGCTTCGTGGACAAG
ATTGCAGGCATAGCTCGTGTCTATTCTGCTGCGGGCGCCGGGTTAGCCATACAACGTGAAGTGTCGACGTATTTGGCGGTGTCTCGAGCATTTGGCGACC
GATCTctgaagacgccgacgccgctAGTTTCCAGCGAGCCAGAGGTAAAGCATTTCACGGTtcaggacgacgacttgTTCCTTATTCTCGCCTGCGACGG
CGTCTGGGACGTCATGAGTGAACAGGAAGCGGTGGATATCGCTTTGCCACACTTCAACGACGCTAAAGCCGCTGCTAACGCGATCGTCAAAGCTGCCTAC
AAGAAAGGAAGCGTCGACAACCTTACAGCTACAGTCGTTCAGTTCGGCTGGAAGCAAGAAACTCCGATACAGCAAGCCCTAGAAGCGACCAAGCTGAGTG
GATCTGAGGAGGAAATCGACATGTTTAAGCTGTGAGTTTAGTTAACGATTGCTATCCTTGTTCGTAGGAGGCGATGAGTTCTCGCTGTTGCAGAATCTAC
ACAGCAACAGGTTTAATTAAGAGGTGATCTGAAACCacaagaacgagaacggGAAGGCACCTTCGCTATCGGCGTCATCGCATCTGTATCATACACTCGA
AAGCGTACAGGCGGCGCAAGCTGAcggtctcgtcgtccatgtttGTGCTGGTCGAGCGCCAGTTGCTGGTCCACGAACACTTCGGCTTCTGCAACAGCAT
GTGCGTGTACGTTGAGTAGGTATCCAAGGAAAAAAAGATCGACACGGCAGCCCCGTACCCACGTGTGGGATGGCGAATCCTCCATTGATCACCATCGCGT
GCAGCCTGATCACGGAATGCGGCGGCGGTGCAATGCGGAGAACGCGGTACTTGGCGTCCaggaggcgatggaggaaGCCTACAACGTTGTCAAACTGCGG
AAGCCGTGGCGTCAGATTCCACCCGCACGGAAGAACCAGGCGAATACTATCCACACAGCACGCACGTCCTGCTCGATGTTTGCTCCGCGTCGCCCGCGTT
CGTTCTCGAGTCGTGAAAGGCGGTACGTGGCGAAGAGGATGGCCACAAGGATCACTGCAACAGGGTCAATAAGGCGTCGACCCCCAAGCAGGGGATCACT
TACCGAGTGCGTGCTTCCTCAACGAGTCCAACATGGCAaacgaaggaggaggccgtcGTGAAGATCTCGAGTTTGAGGAGACTCAGACGAAGCGTCCGAC
GGCCAGAACCAGTGCGAGACCTCCGTTTGAGGACAGTCAAGCGTTAGTGGACACTAGACAGGGGGCACCTGTCTCGGAAAGGCTAATACCTACGCATGCG
TAAGATACTTTTCGATCTTTCGAGACTCGCCACTGGAGCGCTGATATGTCCTGTCATCCGAGTTGGAGCCAAGTTGGACGGGAAAGCTTTCGTTGTGAAT
GTGCTAGTACAACTTGTGAATCATAACTGTTCCCACTTGCCGGCGCAGATGAGCCACCGACTTATTTGCCGGCGCGTCGTTCAAAAGAGGACAAGTGCAA
TTTATTTTACCATTTACGAGGGAGGGGGGTATTATAGTAACTACAAGAAAAGCTGTGTCATTCCTCTTTGCGTCGAGGCTTATGCCTCATCAGCATCATT
CTTGACGGGCGTCGGGCCCACGAGTGCGCATGTCTTGAGCCCGTGTCGGTCCATGAGCATTTGTGCGACGTTGGTCGGCTCGGTCGCGGGGGACTCGTCG
GTCTGTGGACACTGCTGCGTGCGCTGCACCTGCAGGGCCCAGTCGGCCGAGTCGAACCGCTGTAGACGCAGGCACCGAAGCTGATCGCGGGCCTCAGCCG
TGCCCGTGCCAGGTTCGGGTTCCCGCTCCACGTCCGTCGGCGCGCATTTGCCGCACGTGCAGCCGGCGCACGGTGCTGACGCGCGCTGTGCCATCTCGTA
GTCGGCCGAGTCGAACCGCTGGCGGTTGTcgcggtggcgctggatgatGGTGGAGGCCACGGCGTGCGCGCAGTCGCCCGTgggctggtgctggtgctcg
gCCGACGGCGGAGCGGCCTTGTCCGTGGAGGAGTTGGCCATTTGTTGCAGTTGAAAAAGCTGTCGGGTGTGGAGGACCGGACCAAAGGATGAATGACGCA
GGCGTGGGGCGGGGTAGACGtgcgctgcagtgcaaaagGTCGCAGGGATGAGTCCCTCGCAAGCTGTGCACAGCCGGAAGAATGGCGACTTTTTTTCACG
GGATCACCAAGCGATCTTCGACTAACGGCACCAAGGTGAGACTTTGGGGCCTGGTGCTTTACTATGCGCACGTCCTCTTTAATTAAGACTTGGACGCCAA
AGCACGCTGAATTATGCGGCCTTACACCGACCGTCCTGACCGGAGCATGCGACGGTGTCCTGGTCCGGATTTTTGGCGAAACGGCTAAGCGAAGATGTCT
CCATCGAGGATCTTCAACGATTGGCGGCGAGCCCGCCAAGGACGTGACGACACACGCCTCCAGTTACAAGTGTAActtccagcgccttcgcCGAAGCTGC
CAGCGACGCATTGCTGATACAACGCACACGTGTGCATCACTAGTGCCATCAATCAATCCATGCGTGCGCTCATTTACGACTGCGCTGCTAGTACTGTAGC
TCTGTTGGTGTCGATCATCAAGTCGATGGTCGTTGCTGGTCATGCTAAAACAAGGCGGGGGAAACTGTAAAATGAAAGTATCATACCCGCGGTGTCGTCA
ATCTGACCAACCGTTGTCCACATCATTTGCCAAATTCACGCAGGGGGATACTCGACGTCTCTTCTGCACGTGAAAGGGCAGCTTAGAGCTTGTCGATGTA
CGCACCGTCCTCAGTGGACACCTTGACCTTGTTGCCGACCTCGATGAAGAGCGGCACCTTGACCACAGCTCCATTCTCAAGCGTCGCGTCCTTGACACTC
AGCGCCGTATCCGCCACGCCCTTCGGAGTCGTTTTCTGAAGCACAAAATGGAGAGTCAGCGATAGAAGTTCACGCACTGTGAGATGAACACGGACACGCA
CCGTCACTTCGAGCAAGACGCTCTCGGGCATGTTGGCCCACAGCACGTCGCCTTCGATAATCTGCAGCGAAAGCGTCATGCCTTCCGCAAGGAACTCCAG
CTGCCGACCCGAGAACAGGTCGCGCTCAATTTCCATCTGCCAGAAACCACTCGTTAATCTTGGATCCAGCAGAGATACTGTACCAGGCACCTTGTACCTG
CTCGAAGTTTCCGTTGTGCATGATGACGAGGTGGTTTCCGTTGTAGTATAAGAACTGGTACGCCTCGTCCGGGCCCAATGGCGCCTTGTTCACCGTCTCT
GCGGCTCGGAAGCGGCGGTTTATCTTGGATCCggtcttgatctccttgagctccgccTGAATTGATTGACAAATTCTCGTAAGGCCCATTTATCACGTTA
CGCCGCACGGAATTTGCCGGGGGAAACAGCGACTAAACACACCTGAACGTACGCTCCACCTTTGCCAggcttcacgtgctggttCTTGCCCACGCGGTAG
ATTTTCCCGTCGATCTCGAGCGCCATGCCGGCGCGCACTTGGTTGCCTGTTCAATGAAGCGTACCATTGTCATTTTCAGGTGTTAGACAGCGATATGGGT
ATCATTAGAGAGCTTGGCACGTGATGAACAGGATTACTACCATTGATCGTGGCGAAACGCACTCCGTAGCCGCGGGCAGGCGCCGTAGCACGCGCAATAC
GAGTGATAGCTCGCTGCAGCATTTTGTGTGGAATTGGCACCTCTCGTTCAGCTGAAACAGAAAAAAGACAACCATTGTGGATGTAGATATTATCACGGAT
TCTGGATAAAATCCGTGTCATTCTTCAATATCGCCGCGACCGAGCATGTTCCTCTGGCGCGGGCGCCGGCCTGAGGACGCGATCCAGAAGGCTATCGAGG
CGGCTGTGGAGGCAGACAAGACCGGCAGATACGCGGAGGCAGTGGAACTCTATGCAGCGGGCAtcgagaagatgatggcgcAGATGGCGCGTACGTTGCA
GCACAGAATATCCAACCCAAAGGAGTATTGACCTTAAATTTTGCGTTAAGAATTGCCGAACGAGGAAGCCAAGACACACATGCGGCAGAAAATTAACGAA
TACATGGTTCGAGCTGAGAAATTGAAGGAGTGGACCGCGGAGCAGGCGCGTAAGCAGACACAGGTTGGTCCTAGCCCCTACAAAGAAATAAAGAGTGAGG
TATCTGATAATTGTGTGTATTTGAGCGCTGTAGGAGTCTTCTGTGCCGAATACAGAGAGGAGCAGTGCTCGTACGGCGAGTGGTGGACAGGTTAGGAGGC
TGTAGATACTGAATGGAAGGAATTTTTGAGTGACAGGTTAATGTTGCTGTGTTGGCTCCAGAGAGCAGGATATTTGAGGCAGCATGCAGAGCATGCTCAT
ACCATTttggacgaggtgctggaccgcTCGCCTGGGGTGCATTGGACGGATATTGCCGGGTTGGGCGTTGCAAAGCAGATTTTGCAGGTTTGTTTTGATT
CCTGCAGGTTGAGATGGTGGAGGTATGTTGATTAACTGTTTGCTGTGCACGTAGGAGGCTGTTATTTTGCCTACGTTGCGTCCAGATTTATTCACGGGGC
TACGAGCACCGCCCCGTGGGGTGCTACTGTTCGGGCCACCTGGAACAGGTAGGGCGAACCATGCCACAGCGACTTGTTTGCTCTGTGTGAAGATCGTAAA
CTGATGTCGGTTTATGATTGTTGCTCAATTAGGGAAAACGTTGCTAGCGAAAGCTGTAGCTACTGAGGCCAAGGCAACTTTCTTCAAGTACGGCGCGATT
CAGGGTATTCTCTTGTATGCGCATATTCCTGTACTTACAAGCTCGTTGTAGCATTTCGGCGTCATCTTTGACATCCAAGTGGGTAGGTGAAGGCGAAAAA
CTGGTTCGAGCACTTTTTGAGATGGCccgagagcttcagccgTCCGTTGTGTTCATGGATGAGATCGACGCTTTGCTCTCGACAAGATCCGCGTCCGAAA
ATGATGCGAGCCGACGAATCAAGAACcaggtactgtactgtacagttCCAAATCGTTCGAGGAGTCCACCACGCTAATTGTTTCACTTGAATTACGGTTC
TACGTGTAGTTTTTCACTGAACTAGATGGAGCAGCGTCATCACAAGAAGATCGGATCCTTATCATGGGAGCAACTAATCTCCCCCAGGAACTCGACGAGG
CCATTGTACGCCGCCTGGAGAAGCGCATTTACGGTATGCCAGCTTGGAATAGCAAATGCTGTTTAGACTGGACTGAACGAATGCCTTTGTTTACAGTGCC
TCTCCCAGACGCTTCATCTCGTGAAGGACTCGTTCTGCATTTACTTGGTAATCAGAAATTCTCCTTATCATCAAAGGATATCAAAAATATCGTGAAGGCG
ACTGAAGGATACTCAGGCAGCGATCTGAAGGCTGTATGCAAGGACGCTGCTCTGGGTCCGATCCGCGAACTTGGAGCGAAAGTAGCAAACGTGAAGGCCG
AGGACGTGCGAGGGATCAGTGCGTCCGACTTTCAGGTGGCGCTCACTCGGGTCCGTCCAAGCGTGTCCTCGACGACGATAGAGGCTCTGGTCGCGTGGAA
TGAACAGTATGGCGTGTCTGCAGTATGATGCGCATGTTTCCCGGGTTGTATTGCCAAAGTTGTTTATGCCTTCCGCTCGTAAATCATCAAGTACGACTCG
GACACACCAATAAGCTGTGGCATCGTTTCCTGGACGTGCAAGTCTTGGATTTCGTACCACTGCTCGGTCGCCTGTTCGAAATAAAGTCATGAGATCACAC
TAATCGTTAGTTCGCTGTTGATCTGTACTCCATATCGAACTCACGTACTCTATTCTGAACGTGGACACGGTAGCTGCCTTCCGTCAACGGGTTCGTCTGA
AGTGCTGCCTCTTGGCCAGTTGTCGCTGGGCTGTCATGGCAGATATTCGCAGTCAAGTTGTATCTGTTCACACAAACCCCACTACGTTAGACAAACCTTC
TCGAGTTACTACAGTAGTACAAACCAACACAGTACTTGGTGGACGGCAGCGCAACACTCAAGATTTTCTCGACTAGATCGGCCTTCTCAACGCAATCCTC
GGTCGACTTGTTATGCTGGCGTAGAAGAGATCGCAGCTCCGAAATTGATTTCTTGCGAAGCTCTTCCGCAGTCGGGAGATTTTGATCCAGCTTCAAATAA
TCACGCAACTCCAGGTTCTTGACCGGAAAGTTTACAATCGTAGGGTTCTTCTCAGGGAAGAAGTTGTTTCGAGTGAAGCGCTTTACATGGAAAATCAGGT
AGGCAGGTAGCGACTCAATACGgtacgtcttcttcagccgaTGAGAGCCTTGGAGCACATGCGTTACGTGCGATCCATCGTACTTCTCCAGAACTGTGAA
TAGCGGGATCTACGCGGCAACAACGATTAACAGTTGTCCATTTTTAAAGAATACAAACAGGCTTTAAACTAACTCACCTGAGGAATGATATTTCCACCCT
GAGAATCCTTAAACAGCGGTGTCGACGGTAAGTCCAGCGCCATCATCCTAAGGAACAAAAAGTGTGGCCAGGTCAATGACAATACACAAGAGCAATATTA
ACGACAAGGTGAGTAGCTTACAAGAACGGTGACACCGTAGCTGAGCTAGCCGATTCGCGCTCTACTGGATCCGCTGACGCTGCTTTCGTTTCATTGACCG
TGGTGACTTCCACGAAACCCTGGAAACACTTGTGAATGATACTACTACCCGGCTTGTGCGATCCACCAAGTCCCTTAAAAATGCAGCACGTCATTAGCTT
CGCCGCTATTAATCCAACAACTCACTAGTTTTCGTACCCTGTGTAACTCGTTCAGTAGCCAAGCTAGCAGCTCGACACTCTCGTTCTGCGTTCCGACatg
gaacttcttcttgctgctcacCGAAATCTCCTGCACCAGTTCATGCGGACTGATCTGCAGCCATCAGAACCACAAAGAACTCAGTCAGTCTGCACAACCA
ACACCTACATCCCCATACAGCCTCAATACGCACCGTGTTCTTAAAATTGTGCGGACTCCACATCTTCCGTAACAGCTCTCCGAAGCGCAACACGAGCTTT
GATTTGACTTTGCCCATTTGGTtagccaagaagaagtccCGCAGCGGCGGCACGTGggccagcgcctgcaccacCACATTGACGTAGTCTGTGTGCTTAA
GGTTATTTAGCCCAATAAACCCAGGCAGATACGAGACTCCGAAGGCGTCCTGTGCCAATATGCGGTTCTGGTCCAGCTTGGCGATCTGAACAGTCTCGAA
GCTCGGGCGCAGCGCGTCCTGCACGGGCTTGAGCGTGTTGTCCACCACCTCGTAGTTGTCCGGCAGGCAGTAGATGCGGTCCGTCTGGAGGTTAATGAAC
ACGTGGTGGCTGCTCTGCACCGAGTGCGTGAAGGCGTGCGTGTTGCGGCCGCGGCCCTTGAAGTACTTGCCGCACACAAGACACGCGTACACGTTCTGGT
CCGAGAGGCTGATGGAGCacaccttctcgaagtcaAAGTCCAGCAGCTGGTGGTTGATCGTGTCCAGGTACGGGCATTTGCGGCGCTTAGCGGCCGCGGC
GCCGTCGGTCTCGGCCTCTGCCTTACGCTTGGTGGCGGGCATGCTGCAATGGGCTTGAGATTGGTACCCGGTACCAGTGTTTTGCAAAAAAATAggattg
gatgaaaataTAATGGATAACCTGAGGACTTTTCATCCAATCCTGGGACCTCAAAATCGTGGCGTCTATGCGGATCGCCATACAAAGAGCAAGTTATTTT
GATCTTCccatcgtcgctgcaggCTCAGATCGTCGACGCGGCGGTGTCGGCGCAACCAGCATTCCAtcgccgcagcagcaacacttcCTGCCCTTCCTGt
gccttctccttcttcgcttctCTTTCCTTTACTCAAAGCAACCGCTTGAGACAAGCATTTACATGCTAAGCGGCGTCAAGGCTCGATGCCGCACGAAAAG
CTTCATCCATCATCTCGATATGAGTGCACGTAGTGGATGATTTGATCCGACGTCATTGGTCGAGAAGAAGGGGAATTCGTACTTACTCGAGTTTACGGCG
GGCACCGAACGCTGCTTGGACTCACTCTCCAATCCTCCTCCAAGCACCCTTCAGGTCCGAACGTTTAAGGATGATGATGCTTCGCCGCTCGACCGCCGCG
CTGGCCCGCAACGCCGCGCCAGCCACGCGCACCTtcagcgccgccgccaacgcCTCGGGGGAGGCCAAgttcgacttctccactcCCTTCGAGCTGCACC
GTACGTCATGTGCAACGGATCTTCTGTTGCTGATTGGAATCTAAcgcagagtgatggtcataTGACTTTTATCATGCGCAGGTCTCGAGGAGGGCCCGGC
CGAGTTCGCCGTGACCAACCGCGAGGAGATGCTGGGCTACTACAAGCTCATGTACACGATGCGTCGTATGGAGATCACTAACGACAACGAGTACAAGGCC
CGTACCATCCGCGGTTTTTGCCACCTGTACGACGGCCAGGAGGCCGTTGCCACTGGTGTCGAGGCCGCCCTGGACCGCAAGGACTCGTGGATTACCTCGT
ACCGTAACCACTGCATCATGCTCGCCCGTGGTGCCGAGGTCAAGGACGTCCTGGCCGAGCTGTTCGGCATGTCTACCGGCGCTACCGGCGGTAAGGGTGG
ATCCATGCACTTCtacaacaagaaggagaacttCTACGGTGGACAGGGCATTGTCGGCGCCCAGGTGCCCGTGGGCGCGGGCCTGGCCTTTGCCAGCAAG
TACAACCACAACGGCGAGGGCCTTATGCCGTGCGCCATCACCATGTTCGGTGACGGTGCCTCTAACCAGGGCCAGGTCTTCGAGGCCGCCAACATGGCGG
CCCTGTGGAAGCTCCCCGTGATCTTCTGCATCGAGAACAACCACTACGGCATGGGCACGTCCGCCCAGCGTTCGTCCAACAACACGGACTACTACACCAT
GGGCAACAAGATCCCGGGTATTAAGTGCGACGGTAACGACGTGCTTGCTGTGCGCGAGTGCACCAAGTTCCTGAAGAACTGGTGCGGATCGGGCAATGGC
CCGATCTTCGTCGAGATGAACACGTACCGTTACCACGGTCACTCGATGTCGGACCCTGGTGTGACGTACCGTAACCGTGACGAGATTTCGCAGATGCGTG
CCTCGCGCGACCCCATTGAgatggtgaagaagcgcatgaTTGAGTCTGAGCTCGCCACGGCtgacgagatcaaggagatggagaagaaggtgcgtGCTGA
GGTGGTCAAGGCCACCAAGGAGGCCAAGGCTTCGGGCAAGCCCGAGGAGTCCAAGGCTTTCATTGACGTGTACTCTGACGGCAAGGGAAACAACGAGTAC
CCGCCTTTCATCCGTTTCCCTGACTACGCCAAGAGCCTGTACAACGGCAAGCCCCAGCAGTAAGCTCTTAGTGCAGTGTGGAGGTTGCAGAAGCGGCGAG
AGGATCATAGCCCCTCTTCAGGACAAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGCGTCGCCCTGTATTTCCTCTCTATTTCGGCTCGCTGTAAGCAT
GGTGTTGATTGCGCTGTGCAGTGCATCAGAACCCGGCTGGCATTGAAGCTTATCTCTAGAACCAGTCTCGTAAGCTTTGCGACCCCATTAATACCGGCTG
AATATGTAAACGCCCATCGTGACCACAATTGCACAAGTTACAGTTCTGATGCTCCGCGTGAATATGCATAGAGCTTGGTCACTAAATGCGCATTGGCACG
AGTGCGTGGCATCATGCCAATGGCGTTGCCATGGCAACACCGCAAATCGTGTCTTGAGTTTTGACATAGACCGTGTTCAAGCAGCGTTGCACCCTGAAAA
AGTCCTTTTGACCCCAAGCAGaattgaagttgctggagcgtGTTTCTTTGGGGTCGTGAGTTCGCGTGCCAACGGAGGAGACTTCAACTCGGAACATCTA
GTGCTACAAAGCTGCTCAATTCCCATGTTAAGCTTACTGATACTACGATACTAATCATGCAAGTTCACTTCGAGCTGTGGTTCCCTGCGTCGCCTCTGTC
TCACGCGTGTGTACatgcttctcgtccacatACTGACTCACATCTGCACTTGTTGCGGCCGTGCAATATTTTTCTACACTACTTCACCACTTAACTAGTT
CACGGTCGGCCGCAAGTTGCATCTTGATACTTGGGTTTTCGTTGCCGTCGTCATATTTCTTCCAACAGGTTGGAGCGGACAGCGCCTTTGCTCACATGTC
AGTTCGAGTACAGCACGGTCCCCGCACCCTGTGCCACCTCGAAATCGCTTCCGTGGCGGCGGTGCCGCGGTCGACGACGCACCATCGGACtattgttgtt
gttattGCCCTTGTCGCCACCATCGCGAAGCATGGGCGCCATGAATTcgtgctcctgctgcagcgccaccacgcGGAAGTGTGACAGCTTTCGAGCTTGT
TGCGCCAAACTGTTCGCGTAATTGGCAGCCATAATGATGTCCTTGGAGCGGGCCATCGCCTCATTGAactcgaacttctcctcgccgtcaCCCACTGGCG
ATTCCTGGTTGTTCTCGGGGTTGACTTGGATGCGTAAGCGACCAGGGAGAAGACTCGGAGGTGACGCGCGCCTGTGCAGGGGCGACGCTCTTGTGATCGA
ATACGTGGGCGAcacggacgaagacgacgcggtCGATTCGTCATCCGTGTTGTCATTCTCGTCCAGAGCGTCCTCGGGTTGCTGCCCTGCGTTGCCCATG
CGCATTTGGCGCAGGCGGAAGGCCTCGATCGAGATAGCCAGGTCTGCGGGACTGCCACGGCGCTTAGCTGCGAAGAGCGCCCTGTTACGCATGACGAGGC
CATCGCTGAAAGAACGGCTCGGAAAGCTTGCCTTGGGCACACCGATAGCTGAACCTGTGGAGTCGAAGCCGTGCACCTCCTCATTACCAGACGAGAACGT
CTTGTACTCGATGAGTCGGGAGCGGACAGGGTCTAGAAGGTCGTCGTACGACCGGCGCTTTGGGGCCGTTGGTCGGTTTGGTTCATTTTTAGTGACTGAA
AAACTCTTTGCTCGGCCGAGAATGGGGGAGTTTTCGTTCGAGTCGGAGAAGAActggttgctggtggtggagctaAGCGACGAAGTGTTTGTGTTTGGCG
AGTCCTTGCCGCTGGCAGTGTTGCGTGAAGACTGGCGCGCTTGGATGACGCATGCCGTGCAGACGCGAAGCTGGCGCTCGCCGATATCCGGCACGTGTGC
GCTGCGCACCGAACTGCATGAGCTGCAACACACCTCGCCACATTTGAGGCAGTTGTAGCGGCGACGACGTACACAAAACCTCTTGGCGCAGATCTTGCAG
TGGTCCTGCTCGCTCATGGGGACGACTTGTTGGGGAAGAACAATCTCCTCGCGACCTACGCGGAAGCTTTCCGTGTACTTGAGGATGCCGTTGATGCACT
TTTCCACGTGCGACTGAATGGCCGAGTTGGCTATAAAAGCAGGGAGGTCGCCGTTGTCGAAGTTGCACGTGTACGTCATGCGTAGCTCACCCGAGCGCTT
CGTCGAGTGATACATAAAGCCGATCAGCGGAACGAGGTCGCGCTTGAACTTGGGCGACTCGGCGTACTTTTCGAATCCCGTGGGTGCGTCCACGGATTCC
ATGATGCGGAAGGCAGTCATCTGTCCTTGTGCGTCCTCAATCATGTCGACGTACTCGAGCATGAGCAGGTCGCGATCCTTGGCGAATGTGCCTGAGCTCT
TGAAGGCGGCCCACTTGAGAGCGACGTAGCGGTGCGGGTTCGTCGGCGTGGGCTCCACGATGTTCTGCACCACTGCACCATCCAGGAAATCCGACGACAG
CATGGCCATCATCCGCTTGaacgacgccgtcgtcggCGTAATGAGCGACGCCGCGACGTCTTCGATGCTGCAGGCGAACTTGCACACGGCGTGAACGTTG
CAGGGTACGTTGGTGCCGCTGTTAGCGGCGTCGGCGCGAAAGAGCGAGATGCCGTGCTTTTCGTGCACCAACCCCCATGGAATCCCACCGAGCAGGTCGG
TAGCTTCCAGGAGACTCTCTGTCATGCGCTTGGCCACCGTCGTGAGgcgctcgcgctccttcACGCACATTTGCGAGGCTACTTCGACAGGATCGGCATC
GCTGTCGTCGGTGCAGTCCGACCCGTTCGAGGAGccgaagctggagagcgagcgaGGAGTCAACGGGGTCCCTGTCAGCGGCGACCCGGTCGCAGGGCTG
TAGTCTGTCATAATATCTGTATGTAATCGAGCGCTGCTTAATCGTCCAGGGAAAACGAGGGGGCCTGAAAAAGCGACGTTTGCCTCAAGACTCAAATGCG
AAACTGAGCGATTTTCGGCCGAAGCAGGATGGGGCGCTCACCGTTTCTCGTCGCACGTAACAGCCCAGTCAGGACGTACGTGCGGTCGTCTGAACTCTAT
TTAGCGCGAACGGCTAGTGAGCAGTGGCAAGTTCCCTTCTATTTTGTCCCTGACGTACCTGGTGCGAGCACACAGTATCCGCTTGCTTTCCGCTAGTATT
TGATTTTCTGGGAGCCATATACTCGATGCTAGGACAGGCCATGGCGACGATGGCCAAGAGCTGATTTcgaacgtcgtcgctggaCGCACAGTCAAGTCAA
AGCGAGCTCGATGGTACCATCAAGGCAGCGGAGTGTACTAAGTGCTGGATCTACTAAGTGCTGCTCACTCTAACGCTCCGAGCATCCGATTGGCCGgtac
acttcaacttgccgcTGTTCAGTGCCCACTCATCGACGATAACGCCCCGAACGCCTACCGAAGGATAGAAGATAG