Description :
From Genome Similarity Track
Location :
Scaffold_1595:2413- 3662
Sequence
1249 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCGGCGTCCTCCGCCT
CCTTCCCTGACGAGGCCTNTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTT
CTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTC
TCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCG
CCTTCGTGGCCTCCATCAGCGCGGACGACTCGTTCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCGGCGGTTTCGGAGGTGCTTTCGCACTGCG
CGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGTTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCC
AGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATATGAGTCGCCGGCGTAACTTCGCTCTGATTGGTCGATAAGATCGAATCTCAAATG
GGTCGTATACTGTAACGGGGTTACATGAAATAGTGACCCTGTCACTATTCCGGGGTGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCA
GAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGAT
CTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAAGGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGC
TGTGTGCCCCGTCACATATACAGAACGGACCTGGTATTTTATATGAGTTTTTGTAAGCTTTTGGTCAGATGAAAACACATGTTCTAGCGGACACGTTGCC
GCAACTCGGAGTTAGTTTTCTTTATGCGGGGGTCTGGGGGTTGCCCCCCCCACCAGAATGCCTAGAATGCATGAAACCCGACCACAGATCAGGTCCGTTC
TGTATCTGACCGCAACGATAGGTTACCCTTCAATCGATAGAGAGCTGTG