Description :
From Genome Similarity Track
Location :
scaffold_38:24124- 26381
Transcript NameFunction/comments
Plaha_PHALS_04736endo--beta-

Sequence
2257 bases(100 bases per row)
TGATCCCCCCTGCGTCTTCTTGTGCCAAGTTTGGATCCCCCACACCCCCGCCGCCAGTTTTCCGATCAACcgaagacctgcagaaactaATTTCACCTAA
ATTTTTGTCTACTCATGCTCGATTGAGACCCGTTCCGACAAATGAGTGGTGGGGTAACTTGCTGGCGTGGGATGGACAGCGGGATAGCGATCCCGTATTT
TCTGGTCCTTATACTTACAAGGTAGTACCTAGCCAACCCGGTACGATTGGCAGCGGCTTGTCTGTAAGCTATTTGGTACAGTACCGAATGGACGGCCCTT
TGAACGACAATGGAGCTCCTCGCTTCTACTGCCACCAAGCAACAATCAAAAATTGGATTTTCTCCTCTGTCGAATTGGCAAGACAATCATCGGCGATCCC
ACCACTGAGCATCGAGGCTTGGGATGATATGGGCGTCCACTTGTCTATGAGTGGAATGAAAATGTATTTGTCCTTGGGCTCAGCCTACACGACGGTCGAG
TATCGAGATGTACAGGTGCAACTCGGTACTGAGCATTGCATTGTCGCTATTAATGGAGCTCCAGTGCGAGAAAATTCTGAAGTGAATGGCGTCAGCTTTG
TCATTTCGCTTAACAATGGCCAATTGTGGGTACTCTACTTTTTTGCTGACGCTAGCAAAAACACATCTTTGGTTTTCAAAAGCAACAAGCTTACGACAGC
TTGTAAATTTACGGGCGTTGTTCAAGCTGCATTTGTGTCAACGAGTGCTGTTCCGTCATCGATACCTCAAAACGACCACAAAATCTTACAGGTTTATCAC
GCTAGTGCTGGAATTTATCCTAGGGGAGCATTTGTTGAGACACTTTCTTCAGAGTCATTTTCTTTTCGCTGGCAACTTGTGCAAGCTTCAGGAAGCAATC
CAGGAGCACAATTCCTACATTTTGCACTCACTCACTTGCACGCAATGCTAGACAAAACGACAGTTGAACTCAAACCCGAGCTCGTGTTGCATTCCCACAC
GCATGGGCCATTGTTTGCCTACATGTTGATAACTTCAACAAACTCAAACTCAATGTGGATTTGCCATGTGTCTCAAGCTGAAAGTCAAGCAGTTGAAACG
TGCACTTCCTTCTACCCGCCTCGTGCTGGCTGCCTTACGCGCGATATGGTCGACAGACTAAAGTTGTGTCGTATTGTCACCGATGAAATCTATGAAGACT
GGTGCCTTCCTAATGAAGGGAGCTATTATTTTAAGGGTAAAGCTTTACAAAAGTTTGGGACCATGTGTCTTGTGGCTAGGCAATTAGCCGACACTACCAA
TCCGGAAATGCAACACGTGGCGCAGCACGGCATTTCAAAGCTGGTGCAATTGATGTCGCAATTTGCAAACAATCAATCAGCCTTCCCTTTAGTCTACGAC
ACGGTATACAAGGGAATAATTTCAAGCGAAGCCTTGGCCAGGAATGACATCAACGTTGATTTTGGGAATGGTGTCTACAATGATCACCACTACCACTATG
GCTATATTGTGACCGCAGCTGCTATGACGCTATACTTGGACCCACATTGGCGTCACTCAGCCGATGCCGCCAAGCTCCGAAGTATTGTTGATACCCTTAT
ACGAGACGTAGCTACATCGTCGCCTGGTGATAGTGACCCTTACTTTCCACGTTTTCGATATTTTAATTGGTGGCTAGGCCATTCGTATTCTCACGGTGTC
ACTCCAATGGCTGATGGTAAGGATGAAGAGTCGACGTCTGAAGAGGTCAACTTTTTATATGGTTTTGCTTTATACGGCCAAGTCACGGAGGAtcaggagc
agcagcggCTGGCGAAGTTAATGCTTAAGGTTTACGTGCACGCCGTCAATACCTACTTCTTGCTGCGAAACGATGGTCCTGTGATTCATCCCGCCGGCTT
TGCCCGAAACAAGGTTACAGGTGTCTtttttgacaacaagtgcGACTACACGACGTGGTTTAGTCCTAACAAGGAGTGTATACATGGCATTCAAATGATA
CCCGTCTCCCCGATCCTTGAAGTTTCCAGGGCTCCTCAATTTGTTCGTGAGGAATGGGATGAGGTGTTGCACAAATTGCCCATAGTGCACGACTGGAAGG
CCAATCAAAGTAGCTGGACGTCGTTGTTATTTACCAACTACAGCGTTTTAGATCGTGAAAAGGCGTTTAAAGTGCTAAAAAAGTGCCCCATGGACGACGG
ACTTAGTCGTGCCTGGGCGCTTTATTATGCCGCAACTCGACCGCCCCCTTTTTGCTA