Description :
From Genome Similarity Track
Location :
Scaffold_566:24122- 25889
Transcript NameFunction/comments
Phypl_g9454hypothetical protein PHYSODRAFT_354994
Phypl_g9455ubiquitin carboxyl-terminal hydrolase, putative

Sequence
1767 bases(100 bases per row)
CTTTAGCCTCAAAACTCTCAGTCGTCTGTAGCCAAGCGAGCCTCATGCAGATCCAGATCAAGGTAGGAGGAACCCGCTGGGGCCACTTGCAAGAGTCGAG
GCGCTAACTGTCCCTGTCGGTATGTCCCTCAATCCGCAGACACTCACGGGCCGGAAGCAGACGTTCAACTTTGAGCCGGACAACACGGTACGGGCCGGAG
TTTGACCTTGACGGGGTTGGTATCCTATTCGCTGCTAGACTGACGCTGCAACCGCCTTGAGCAGATTCTGCACGtgaagcaggcgctgcaggagaaggag
ggcaTCCAGGTGGACCAGATCCGTCTCATCTACAGCGGCAAGCAGCTGTACGTCCAGTCTAttcgactcggaggaggagggggagTTAGCTGACTTCTCT
TTTGTGTctgacgctgttgctgccatGCAGAGCGGacgacaagacgctgcaggactACAACGTGGCTGCGGGCGGCACGATCCACATGGTACTGCAGCTG
CGTGGCGGGTGCTAGAAGCGAGAAGCCGAGCGTTTTGAACGGGGTGACGCCTGTGGGAAACTAAGACAGTTAGAGCAACACGTCGCGGCCTTCTGCAGGG
CTCACAGACTCCAGCTGTGAGCAGCCtctcacgctgctgctaaaCACGCCTCAAACAGCCACTATGCACGTGGCTTTCTCGTCTCTTTAATGCTCTTGTT
GTCTTCCCTCTTCCGTTCTCTCTACTGCGCGTTCGTGGGCTTCGCTGCGTTGGCAGCCGCGGGGTTGCGagcatcgagctgctgcttgatcaGCGGCTCC
aactgcttcttctcggccagcgtcttgagcagctgcatgaTGAACGGGATGTAGTTGTGCTTGCGGCGCCTGTTCTCCAGCGCCCAGTTCtcgtgcttct
gctgctcggcagcgAGATCCGCCTggatctgcgccgcctcgttCTCACTCCCGCCGGCCTCGATGAtggcgtgaagctgctcttcgaACGTCTGTATCCG
GTTcttcaccagcgccagcaggttGAAGCGGATCTCCGTGGCCGAGTACTTCTCGATCCTCTTCTGGATCACGGGGCacgccacctgcagccaAGCGTCG
CGAGTTCCGACCTCCGGCACGTCTCCGAGACAGATGGGTCCTTCCCTCAGCCCGTCCAGCTCGTAGACCTTGCCGTTCACGGGCACGTAGGCCACAAAGT
GAtacacgtcgtcgtcctccgtcgCTTTTctctcctccacgacgaaCGGCTCGGCCCGGGCGAAGGAGTTGTGGGCCATCCGGATCTTGTCGCTGTTGGA
GATGGCCAGGCCCTTGAGGTCCGAGGGGAAGTCGCCGGTGAAGGCCTTGAACTCGGACAGcgtctcgcccagctcgaTGTCCTGGCTGTTCAGCAGGATG
GACAGGATGGCCTGCGTGGCGCAGGCGTTGCTGATCACCtgcttggcgaagaagagtCCGTCCTCTTCGCTGGCGAAGACTGGGGGatcggcgtcctcct
cgtggtTGGCCTCGTACTTGAAGAGGAACACGAGTCCGTAGACGGGGGACAGGTCggcgaactgctgctcgtccaaaGCGTagagctcctccacctgcac
gCCCTTGACGCCGATGTCCTCGATGAGGGCGGTGAACACGCCTGCGACACGGATACGAAGGTTAAGACACAGGGGATTAGAGTGAGGCGGGCCTGGAGTA
GCGACGTTACCCGGGTCGGACTCGATGGTGCACCACGACATTCTTCTTTGAGAAGAAGATCGGCGAA