Description :
From Genome Similarity Track
Location :
Scaffold_2020:2412- 3589
Sequence
1177 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNTCTCCGGAGGTGTTCGAGCTGTTCGACGACGTGCTCCTTCTGAACGACGGATACGTCGTGTATCACGGCCCTCGCAGTGAGG
CGTTGGGGTACTTCGAGAGTCTGGGTTTCAAGTGTCCTCCGAGTCGCGACGTGGCGGACTTTTTGCTTGACCTGGGCACAAACAAACAGCATCAGTATGA
GGTGGGCGGCAGGGTTCCGTCTAACGCTAGTGAGTTTGGTGAAGTGTTTGATAAGTCTACTATCCGGCAGCAAATGCTGCGTGAGTTGGATGTGCCGGTA
GACCCCTCGCTTCTCGCTCATAAAGAGAAGTTTATGGATCCTCGTCCAGAGTTCCAGCAGAATTTCTGGGATGGTACGCTAACGCTCATCCGCCGGCAAA
TGACAGTAACCCTGCGTAATACGGCGTTGCTGAAGAGCCGATTCCTGATGTCTATCCTATTGGGGCTGCTGAATGGGAGCACCTTTTACCAGTTCGACGA
GGCAGATGCTCAGGTGGTCATTGGTATGGTTTACGTGGCGATCAATTTTGTGACGGTCGGCCAATCCGCACAGATGCCGATATTCATGAACCTTCGCGAC
GTGTTCAACAAGCAGCGTGGGGCTAACTTCTTTCGGACTTCATCCTTTGTGCTGGCGACTTCGGTGAGCCAAATCCCATTGGCGGTCATGGAAACGCTGC
TCTTCGGCTCTATCATCTACTGGATGTGTGGGTTCGTATCAACGGCTACGGGCTTCCTTTTGTTCGAGCTCGTGACATTTCTGACGAGTATGATGTTCGC
TGCTTGGTTTTTCTTTCTCGCTGCCGTGTTGCCGGATATGAATGTAGCAGGACCGCTCAGCCAGCTCTCGCTTTTCTTCACGACTCTGTTTTGTGGCTTT
GTGATCACAAGGGGGCAGATGCCAGACTATTTAATCTGGATGTACTGGATCAGTCCTCAAGCTTGGAGTCTTCGAGCGGCAGCAGTGAACCAGTACACAG
ACTCCAGCTTTGACGTCTGCATTTATGAAGACGTCGACTACTGTGAGACCTACGGCATGACAATGAGTGAGTACTCTCTGAGCTCATTTGACGTTCCGAC
CCAGCGGGGGACTATGGTTGTGGCTGGGTATCACGTATCTGGGTGGTATGTACCTCATCTTGATGACGATCGCATGG