Description :
From Genome Similarity Track
Location :
contig_65:241156- 242964
Transcript NameFunction/comments
g9551.t1hypothetical protein

Sequence
1808 bases(100 bases per row)
TGAGCGCGTTGGGCTTAATACAGCGAATAAAGTTGCACCGCGTCGCATCGAGGGTGTCCACAAGCTCCTGCATCTGGTTCGAGAACTTCGCAGCCACACT
CTTCGTCAAATTTCCTCTTGCCGGGGCGACTGTTGTCGGCCTCCTGCTTAAAGAATGCAGGCAACAACTTGTTCGTCGAGCCCAAGAAAAGTTTCGCCAT
GTCAGGCGGAATCGAGTCGTTGTTCTTGTCAATGAAAGATCCGATCGTGTAGCTCACAGCACCAGCGAAATGCCTCACAATGAACATGTGCTCCATGTCC
TTCGGGTGTGGCCGCGGGAAGTACGCGTGTCTAGCGTGCTTCGAGTGAAGCGTTCGTAGGAATTTCGCGTCGCTAGGCTGTGGGTTCATCGCCTCGGCAT
CCAGCAAAGCCAAAATACCGTTGGGCTTGGATGCAATCAAATCCACGCACTCGCGGTTATCAGGCCATTTAATTTTGCCCACCGTGATACCTTCACGCTT
GTACAGTTCCATCTCGGCAATGAACACCTGGTTGTTAAACGTAGCCTGCAGCACCTCGTTCGTGTAGTTGATCAACAGCTGCTCGAAATCGTTGCGCTGG
AACGACTCGAAACCGAAGATATCTAACACGCCAATGTAAGGCAGTGGGTTGGGATCGTGGCCCAGAGACGAATTCACTTGCTTAATAACCCAGTCGAACA
AGCGGCTGTACAGCGCCTTGGCGATAGCGTCACGTGCATACACGGCAGCCTGCTCGTTGCGGCGAACAGTGAACGTCTGTTCGGGCGTCACAATGTCGCG
CGTCATCATCACCTTCCACAGGTCCTCCTCCTTCACACCCAGCAGCTTGGATACCACAACAATTGCTCGCTTGGCAGATTCCTTCTCGATCACGGCAGCT
TCACCCTCGGGCGTATCTTCTTCTTCAAACTCGATGTTACCCAGATGCAGTAGACCCGCGACTACCGAAAAGATAATGTGCTGGACCTGCTCGTCGATGC
CCACACAGCTCAGACCACGCACCACAGCCTCGAAGCACGCGTGGTCGTCCGTTTCTTCGGCAATGTAGCAGCCGCTCTGGTTCAGGTAGCAGAAGTCCTG
GGGCTTCGTCAGCTCAAACTCCTTACGAGCCGCAGCCGAGGCGCCGGCCAGCAACTGGTAGAAGATGTGGAAGTTGCGCTCGCCATCCACTTGGTACACG
AGACGCGACTTTTCCAGCAGGTACGTCTCGACCAGAGCACCGGCCAACTTGAACTCGCCGTCCGACGTGAACTGTAACTTCATGAACTTGCCGAAACGCG
ACGAGTTGTAGTTGCGCAACGTCTTTGCGTTGCCGAACGCTTCCAGGATCGGATTCTGTTCGATCAGACGGTGGTCCAGCGACGTGCCGTGCTGCTGACG
AGTCTTAGACAAGGTCTCGATCTCGTCTCCGCGCGCCTTCTTGCCGTACAGGCCGCGCGTGGTCAGGTGACGCAGCACGATCTTGGACGACTCGGTCTTG
CCGGCGCCACTTTCTCCACTGATGACGACTGACTGGTTGGTCGGCTGGTCCGTGCCCGAGTTGTAAACCATTTGCTGGTACGCCATCTCGGCAATGGAAT
ACGGGTGGGGGGAGCTACCTGCCGTGTTGACGACCTCGCTAATGGGCGGGTTGGCCAGCTCTCGCAGCGGGTTCACGGCGATCAGCACGTTGGCCATGAA
CGTGTAGGGCTTCTGGCCGGATCCGTCGCCGCCGTCGAGCTTGCAGCGCTCCTCCAGGTTGTGCAGCACGCCGGCCTCGTGGATGTAGTAGAGCGACGTC
ATGTCGTC