Description :
From Genome Similarity Track
Location :
Scaffold_1671:2411- 4612
Transcript NameFunction/comments
Phyag_g11235aspartate aminotransferase, putative
Phyag_g11236Crinkler (CRN) family protein

Sequence
2201 bases(100 bases per row)
GAATAGGAGAGGCGACAGACGTGTACGTTTCGGACGCCATAACAAgcatgctgctgcgcaaccaGTCCATACTGGGCGGGAACAACCAAAAGCCCATGCG
ccagccaccagcgccacacCATTTGCTCAATCCTCCCGAAACGATGGTACCTTCTGGATAGTACTTGGAAAGCGACAAATGAGTACCAGAATGGTGCAGC
TCCGAGTAGATTTCATCCGAGACGACGAGGATCCGGTATTTCCTTGCTACCTTTGCAAGTGCCTCCAGCTGGCGACCGAAGACCGATAACACAATAGTTA
TCAGCTCGCGGACTTCATTCCTAAGAAGAAAACATTACCAACCTCGTCGGCCTGGTATGCGCAGCCAGTGGGATTGGACGGACTGTTGAGAATGAGAATC
CGGGGGGCATCTGAAAGAAaaaagcaccaccaccattaCGATGCGCTGTCAGCACCCGTTGAGAGATGATACCAGTCTCAACAGTATGCACACCTGGGTC
TTTTGCACAATGGGCGTCAAGCACTTCTGGACGAAGCACGAAATGGTCCTCAGCATGAGTTGGCAGCCACATCATATTTCTGTGGGCGGCAATAGAGAAC
CATCACGTCGCGGTTTACAAGCAAGCCTGATAAGTGTACAGAATCAGTTGCTCACCCACCTTCCCGCAATAGCAGCCTGTGGCGCGTAACTCGTACAGCT
TGGATTCGGCAGCAGTAGGTCTCCATAGTACACTGTCTGTAATACAAAGAGCAGTTCTTTCGTCCCAGGACCCACTAATACATCATCTCGCGAGTAGTTC
ATGTGTAACCGATCCGTCCCCCATGCAGCAATGTCGTCACAAAGCTCCGGCAGTCCCGCGACAGGCAAATAGTCTCTCTGATGCGAATTTGTCCTGCACC
AACACCCAATCACGTTCcatcagcttcaacgtgTATCAATACAACCCCAATCTTGACTCACCGCAATTCATCGATAATGCACTGCGGGATCGGGAACGGC
GACTGACCCAATCCTAACTTGTAGATGCACTTGCCTCCTCTGATCATCTTATTACTCAACTCATCCAACGCACTGCCCGCCGCCGTGCACAGCATCCGAA
TTTTGCAATTAATCACCTTCCGAGGGCCTAAAGCAACAATTCATCAACATGTAAACACCGTGTTAGCCTTCGTTATAGTAATTTAGAACACAGAATGTTG
CCCACCTAAACTCGGCGGATCTTCCAATTGACTTGCTGGTCGCTTCTGTCCTGTAATATTTCTCGCCTTTTGTCGTTCCGTTCCAACATCTTCGCTGCTT
GTGTCGCTCTGAGCGTTGGTCTCAACGGCTGATGCAGATGTGATCGACTCCGTTGCAGATCCCGAAGCTTCGGAGGCGCGACGCTGCACCCGGCGCTGTA
GCGTGCTGCGCGCCACGTCGAACTTGCGCGCAGCCTCTCGTAGAGACATGGAGCCGCTCTGCacggcggcgatggccgCCTCGATCTGCGCCGACTCGGT
CGCCTGCCTGGCCATTCTGTAAAGTAGTCTTATGTAGTACGGTCCAGTTTATAATGTTGTGAAGTACTGGTTCCTatagttgctgcagagcagttTAGCT
TTTGTCCCATCAGGTTTTATGCCGTAGTGCTTTTGTCCCGCGGGTTTTGCTAACTTGCTACAGATTGGAGAGAAAAGAACGGTATCTGGGAAAGGTGAGA
GAAGGAAAGAGGGAGGCAGAAGCGGAGAGACTTCAAGTAAATAAATACTATCGGCAGCCTTCCTCACAACAACAAAGGTCGTTGcattcgtgttcgtgtg
cgaTACTTGAGTTGCCAGCTCatgcaagaagcagcaagttaCAAGTTATAAAATAGTGTTGATTTTATATAATATAATACGCGTTCGTATTCCGTGTTTC
ATCGTTCCTACCGTATTGAAGTTTAGCGacaccttcatcttccgtATTGAAGTTTAGTGACACCACTTCATCATTTCCGCTTTGGTACATTCGAGGATCT
GCCGCATAGATGATAAAGCTTTTCTGCGCTATCGTTGGTGTCGAGGGAAGCGCGGTGTTCCCTGTAGACATCGACCCGAGTCTGTTGGTGATCGACTTGA
AGGATTCGGTCAAGGAAAAGAATGAAGACATCAAGGTTCCTGCGCGTgtgttgcagctcttcctggcaAAGAAGGATGACAACGTGTGGTTGACGGAAAA
C