Description :
From Genome Similarity Track
Location :
scaffold_1487:2411- 4276
Transcript NameFunction/comments
Pl_100624hypothetical protein PHYSODRAFT_341850

Sequence
1865 bases(100 bases per row)
TGCCCCGCAACCAATGGATTCCAGGCTATCGCGCTCGGACGTGTGTGTCGGCTATACACATACAACCCTGGCATGTCAAAAGCGTACGCCGTATCTGTGT
GCTGGAGATGGATTTGAACTTGCTCTTCCATCACTTCTCAAAACCCAAGTACTGGATATTCCCGCGAATTCGTCCGTCACATGCTCGTCGACAATGGCGT
CCCGAACTCACCACCGAAGCTCAAGTGAGGGCCCTGTATGCAACCACCCCTTGGCAGGGATTGGCTATCCCCGTGGCGCCGATTTCGTTCGTGGCGGCGG
ACTCCCTCGAAGCTATATCTCAACGCTTCTCCGCATTCCAGGAGCACCACCAACAGTCGTTGTGGGAGGCTACCCATTTCTATCCGGTGTCTGCGCAACT
TCGGGCGAACAGTACCTACCTGGCTGGGCTTTGTCGTGCCCGGGAGCAGCGCCGTCCAGGCTTGGTGCGGCCTGGAAACGGTTCTTACAGTGGGTGCTTC
GCGGTCTGGTCGCCGGCCAGTGTGATCTCGATGTGTCCTTGGATCCCTTCATTCTTCACTATCCCCGTCCCGGTGAGCAGTCTAGATTGTATCCTGGACT
TAACTGCAGCCCGGCACCTGTTGATCTACTAGACGCCCTTCGTCTAGCGGATGACATGGAGCCGTGGCGCAACCAATTCCGTGCCCACCTCCAGAATCAC
CCTGGATCGCGGCTAGCTCGACTCGCTGGTAAAGTTATCCCTTTGGATGAGGCCTAAGTAGACTCGGTGCCCGGACAGCGGTCGGGACGTGCGTCGCTTC
CAATCTAATCGTGAAAACTTCTCTTTCTCTCGCTTGTTCACTCATATTACATGTATCCCCTCCATCTCATCATGCAGCCGTCCTGCATGCCCTTCACTCC
ACTCCTCCTCGTAGCAGCTAGCCCGCTACGAGTAATTCGCCTCCTCTTCGTTAGACTGCATCGCCCCAAAACGGTGCCTGCTCGCGCGACTGCGTTCGTA
CTCTTGTAGAAGAGCGCCGCAGTTGAGGTCTGCCTCATCTACCCACGTGGGCTCGTCGTAGCCCTTCCAGTAAACCTTGAACTCTCGATGCGCTCGTCCA
TAGCGCGTACGTCTTCCCGTGCGCATGTCTACGATGCGCTCCACCTCGTACTCGCCATCTCCCATCGGGGTCTCCCAACTGTCTTCTGGCAGTAAAGCCT
CGTCAAAGTCGACGCGCTCGCCTTCTTCCACTGTCAGGGCCGCCTTCGGGCGGTCTGGGTACACTCTCACCGGTTTCAACTTCGAGAGGTGAACTATAGG
GAATATGCGATAGCCCGGTCTAGCCGTCTCCAATCGCGCTGCATGGTTGTCGATCATCTCAATACACGGAAAGGTCCGTGCCACATGTGCGCAAGCTTGC
GTGCGTACCCCTCCTTCACTCGATCTAAGTATAGCCAAACTTGTGTCCCTTCTTCGATCTTGTGCGGTCGGACCTGCTCGTTGTGTTGATCTTCCCGGGC
CTGCATAGCCTCGCGTAGCTTCTCGTTCACCACTTCTGGCCCGGTGATACTGTCTCTGTATTCTGTATCGCCATCTTCGTGGCTCGGAGTCTCTCCGCCT
CGTCGATCCGAGCGGGATGCTCGCCTCTAGCGTGGATCGTGGGTCCCAGCCGTGAACTAAGTAAAATGAGGTATCCCCTCGCGTCGTGTCTTGCGCTGTA
TTGAGTGCGAAGGTCAGACGTTTAGCATAGTCGTCCCAGTCTTGCTGATTAACATTCGCGACGTACATCTTCAATGCGCGGGTCAGCGTCTGCACCGTCC
TCTCGGCCTTTCCATTGGCTTGCGGGCGGTATGCCATAGTGGCACTCTGCCTCATCTTTGTTGTC