Description :
From Genome Similarity Track
Location :
Scaffold_70:241061- 244261
Transcript NameFunction/comments
Physo_139127hypothetical protein
Physo_139128hypothetical protein

Sequence
3200 bases(100 bases per row)
GTCAAAATTAAAATTTTGACTTTCACGTTCGAGCAGCACCAGCACGCGGAGTACAACAAGCGCCTGAAGGCAGAAATTGAGGATCTTAAATCTCAACTCG
CTCATCACGGCATCCGATTAGAGAAGCTCAACTCTCAGCGCGCTCAGGACGAAGAACGATTTCAAGGAGTTCTAGCTGAAATGGAGCAACTCAAAGCAAA
AGTTGCCGCATTGTGCACGGGTCCTCATGTTGCCTCCCAAGGGATCGACCTTACCAATCCGCTCTAGCCGCCACTACGAAGTTGCCGTTCAAGCATCTGG
ATTTGGGCTGTCTCGTTCATCCCGTGCAGTACAGGGCTTCAATGCTGCACCAGAACAGGTTTGCTACGAAGATCGAAATTTCTAGTTTAGCTTGCTAGTA
GTGGGAAACGAAAGTGTTATTGAGTTTGTTGCTCCGTGCAGTGCTCACTCGAGACAGACTTCTCGGAACTAAGTGACGGTGTCTCCCTTCTCCCTCCTAT
CTTGCAGCCGTTTACTCCACGTGCACTGGTTCGCTCGTGTCCAGCTCATTGAACTGGAAGAGATCCGTCTTCTCCGTAAGCGGTTCCATGTAGGTGAAGA
ACTCAGCGTAGTACGGGTTCGCCTGGTGGATTTTGAGGCTCTGCTCGACCAACAACCACATCAACAACTCAGTCAGCATACTATATCGGCATTCAACAAC
AAAAAACAATACGCAACGTACACTTTCGCGCTCGTAGCGCTCGATAATGGCCCACTTGCGTGTGTCGACGTGGTCCTGCATGACGTACCAGCCGACGACC
TCGGCATCCTTCACGTACGTCTGCGAGGCCTCGATGAGCTTGTTGCGGATTTTCTCTTCGACGTCCTTGCCTTCCTTAGCGCGGAATTGGACAACGAGCG
TGTAGACCATCTTGGATGTGGCTTGAGTGGAGTTTGGTGGCCAGTTGATAGCAAATTGCAGAATGACGTAGCTGAAGAGCAGAGCGGTGTGAGCTGCGAT
TGCTGCCATGTTGATTGCGTTCGTGTGATGAGGTAGACAACCTAGATTGACGAAGTGTTGACCACTTCCTTCTTGACCTTGCCCAAGACAGTAATCCCCG
GCTCAACTTTCGCACTTCAACTTGGTTAAACGAACAAAGAGCAAGACTGTGCCAATGTAAATAAGGCGTTGCGAATCATGACACCGTCGACGCCCTAGCT
CTTCCGCAGCGAGCCTTTTGTATCCGATGATCTATTATACCTAATGGGAGCTTTATACGGTCAGGTCCTCGATGCCTGACGAGCTGCAGCGTTCAATGCG
CGTGATGTCCCAGTCTCGGTCATCCGTCGGCGAAAACGAGTTCACTGCTGCTAGCGTTTCGGGTGAAAACATCCCAGGGGCGGCAGGTGACACGGCCGGC
GAGCCGTCGGAGAGTGGGACGCCACGACTCGCATCCACCTCGAGGTTGTGCTGCGGGTGCTTGCTCACGAGCTTGTCCATGGCCTGCCGCATCAGGCGGA
TGGCGGCCTCCTTGGTTGGGTCGCTCGAGCCGCGCTCCTGCAAGATCCGAAGCACGTTCTCATGGCTCTGGATGGAGATCAGCAGCGCCTCAGAGAACGA
CGCCATGTCGATATCCCCCAGATCCAAGTCTTCCGCAGGCGTCGCGACGAAGTTGGCCAGGTACACGTCGTGCAATACCAGCACGTCTGTCAGCTCTGGG
TACTGGTACCGGAATGAGTCGGCAGCTACGAAATGCTCGGGGTCCCAGCGTGGCCACTTCTTGGCTGCAGCTGCAGTTTTCACCTTCGCCAGCTCTGCGG
TGATGCATTTCTGCAGACGTTGCCGCATGCTGACTGTCCATACCAGCGTTGCAGTGCTGATATCTTCGGTGGTTTGTAGCTCCAGAATGAATTGATCTGG
AGACGTACGCAGTACCTAAGCAACAACGACGTTAGCATGGCATAACGACAAAGCATCATGGCAAAGCGATGAATCGACGTACTCGAACGAAGCTTGGCGT
AAGAAGCTGGTACAGCACTTGCGTCGGTAATGACGGAGCGGGGGCATTTTTGGGCCCCAGACAAGCCCGCAATACCAAGGCTGCACTACGAATTGCACCG
AAGAAGCGTGAGGGCACGCGCTGGACCTCCTCGGGTGGTTGGTTGGTGGCGTGACCATTGCCATCACTAGCTTTCTCACTTGTCTTCTCGACTTTCGTAT
CCCCTTCTCCGCTATGTTGACCAACTTCAGCATCGTCGCCATCGGAGGTATCGGACTCACTTTGGTCGTCTGTTACTGGTGATTCTGCAGAGGAGGGTTT
CTCAAACTCTTCAGCAGGGCAGAACGCGACAATATCAATAAGTGATAGCAGCCCACCAGCAGCAACCACCAGGGCCCGAAGTTCATCGTAGTGGCATAGT
CCACCGAGACAGCTCAGACATACACTTGCAGCGTCAATGTCCGCATACTGTGTGATGACTGGGCGTGACGCTAACTCGAGCAATGCGGTGACGACTTCAG
GATTATTTGTGAGCGCTTGAATTCCAGGTTCGTGCTGCTTTGCCAGAAGAGATAGCACGTCTGTCGACCGATACAAAAGTACTCGCGCCATGTTCTGGTT
ACTGGGGTTGCTCCGCCGACGGGGGCCGAACACTTCAACTGTTTGCAGCAATTGCTGGAATGCCGGGCTGCGCATGCGTTCTAGTGCGTCAGCTAAGGCT
TTCAAGCCCTTCTCCTTCAGGAACAGTCGACACGCAGCTGTGTTTACACTGCGCGACTCTGAGACAGATAACAACGCCACAAAGAGATCCAAAGACAAGA
TCCCACGAATTTGGTCCACCTCACTAAGCATTGATCGGCGAAGAGGTGCCAACAAGGAGTCATAGAACTCTGCCTTGATCTTGACCTCAGCACAATGTGA
AGGGACGAGTCGGGCTAGCGCCTTTAATATCAGCACCTGGACCTCCCACGGCTCAGCAGCACACGAACCGCCACTACTGATTGAAGACTGGCTCACGGAC
GGTTGCTGCGGTGGTGAGGGTAACGGGCCAACACTTCCACCTCCGATATACCCGGACTTTCTCCGGCCAAGCACTACCAGCTCCTCAAACAGCGCATTAA
TCAGCTCGCTGTACATTTCAGGCGCCCACTCATTCAAAAATTCGCCGTCGCCTTCAATATAAGAGCGAAGAAAAATATTGCCGATGAAGAGATCGTCATC