Description :
From Genome Similarity Track
Location :
Scaffold_1332:241- 4057
Transcript NameFunction/comments
Phymu_g13124hypothetical protein

Sequence
3816 bases(100 bases per row)
GGCTCGGGCTCGTGCGGTCTGATTAAACTCGTATAGCAACGCGCCACAATTTAGCTTCGACAACGGTAACCACTCAGTCTCGTCGTACCCCTTCCACTTC
ACAAGATATTCTCTGAGTCGCTTGGCGGTCCGAGTTCGTTTGCTCCACCGAGTATCCAGAATCTTTTCCACCTCGTACTCATCGTTCTCAGTGTCGGGTT
CCCAGCTGTCTTCAGGGAGCAAAGCAGCATCAAAATCATCATCCTCTAGTACATCGATTTCCAGAATCGGTCGTTTGGGAAACAAAGCTCTGGGTTCCAG
ACGGCTTATGTGAACCCAGGGGTTCACATGGTATCCGGTGTCTTCAATCTTGAGCCTCACACGAAAGTCATCTAGCATCTCCTCAATCCGGAAAGGTCCG
TGCCACATGTGTGCCAGTTTACGGCTCAGTCCAGTCTGCACTTTGGGAATATACAGCCATACTGCGTCGCCAATAGCAAAACCAGACTTCAGACGTTCTG
ACAACTCGTTCCACTTCCTTGTCTGTTCTTCAGAGCGTTCacgcttggccttcttctggagTTCTTCTGCACAAGCTTGAGCGTAGCTATAATCTCTCTG
CATCTTCCGACGCCACTCGTAAGCTGTGCGCTCCTGAACGGAGGATGGCTTCGGACCCAACATCGCGGACACAGTCCCATGAGCATCCCATCCGTGTACT
AAGTAAAACGGCGTATCCAGACGAGTTGCATCAAAGGACGTATTCAGAGCGAACATCAGGCGTTCCGCATGGTCGTCCCAATCACTTTGGTCAGCTTCCG
AAATATAGGCCTTGATCGCGCGCACCACAGTCTGTACAGACCGCTCCTGTTGGCCGTTGGCCTGCGGGCGGTATCCCAGAGTAGCACGCTGTCTGCTTCC
GAGAAGTTCTCTGAAACACCTGAACACCTCACTCATGAAACGGGGATCTTGATCATGGCGTATCAGAGAACTGGCACCAAAATTTCTGAAAACTCTCTCT
TCGTAGGCTTCGGCGACATCTTGGGCTGTAGTGACACTCATAGGCTTGCACATGACGTATCCAGAAAACATGTCTtggaaaagcagcaggaatGTGTTAC
CCCTGGCGGAGTTCGACATATGAGTCACAAAGTCCATGGACACCACTTCAAAGGGTCGGCTGGGTTCAATGTTCCCAGGCGAGGGTCCAGGATTCGGAGG
GCGCCCCTTGCCACTGGCACAGTCAACGCATTCCTTCACGAATCGTTCCACATCTGCATACATGCCTAGCCAGTAGAATTCAGAACTCAGCTTTTCAAAC
GTGCGCTTGATCCCTTGATGGCCGCCTTGGTAGTCTTCATGGGCGTAGTGCAATAAGTCCGAATGCAAGTCTCTGGGAACCACAAGTCTGAGTTCATCGA
CATTATCTCTAGGACGTTCTTTGGTAGCACGACTTAGGCGATACAGCACATCTCTGGAATCCAAGGCAAAATCCTCTGCGACTCTCGCAAGTTTCCTCGC
TCGGGGACGTGGTAGGCCTCCCACGTCACCTTTCAGGAACTGCATGAGTTCGACCAGGTAAGGGTCTTGGTTCTGATGTGCTTTAATTCGCCGCCATCGT
TCTGCCTGGAACTCCAACGGGCCTGCGGGTTCGCGTCTTTCGTCATCGTCGGGTGGTTCGGCCCCTTGTCGGGCTTGACCACGGGTAATGGCTGCGAACA
CTCGGGCAGCGAGAGACAGCGGAGCGGACTCTGGTCCTGGTTCATCTGCATCAGGAGCAAGCATCAGGCTCTCAGGATCCTGGTTCCCTGAATCTCCAAC
TTCAGACTTTGGCGTCTCAGACTTTTGACTATCCGATGGTTTTACCAGTTTCTCATGGATCTTGGACACTAACCGCAAGTGAGTAAActcgtctgcgtct
tccactCGCCATGATTCACCTAGTGATaaagtcttcgtcgtcaggTAGTCTGCGGCTTGATTGTACTCGCGCTTGAGGTGAACCAACTTCAGAGATCGGA
ACTTGGTTTTCAGGGATTCAAACTCAGCAAGTCTGCGTTGCAGGTTCGGCTGGTTACAGTTAATCAAGCCCTGAGCCTGCTGGATAGCTATCCGAGAATC
TCCGACAACCACCAGGTCCCGAATTCCACGCTCCAGTGCCATCTTCAAGCCGTTCAACAGTCCACAATATTCAGAATCGTTCACCGTGACTTCCTTCAGC
GCAAATCCCTGAGCCTCCAAAACACTCCACCCTGGTAATTCCCAGAGTATGCATCCACAACTTCCCAGACGAGTAGACGTCTTAGCCGCCCCATCGAAAC
TCAGAACGCACCCCTTGTAATCGGCTTCCAACATCTCTATGCTGATCGGTGTCGGAGGCTTGNTCCAATGTGACAACTTCAGACCCCACTTCACATTTCT
GCCATCGGCGGAATCCGATGTCAGAAGCCACTTCAGGACAGAGTATCTGGTATACACCACGATCACAGGGCTTGACTCAACCAGAGTTCTGAAATTCTCC
AGCACTCTGAGTATAGCGATCACCTCCTTTTCAGCAATGTGATACCTGATCTCGGCGTCGTTCAGAACACGTCCGGTAAACCTCACTGGGTGAATCACAC
CATCGTACTCCTGACCCAGAACCGCCGCAGCAGCCCACGGGTTTGCGTGTGGGGTGATCACGAAGGGCTTTGACCGGTCAGGATGTCTGAGGAGCGGAGT
CGACACAATCTTGCGCTTCAGAATTTCAAAGGCTTCACGGGCGCGAGTCAAGTCTCGTCCGGCACGAATCTGTTCGTCCGTCAGCTCGTAAAGGGTAGCA
GCAATCACAGGTAAGTCTTCAATAAACTTGTTGTAGTAATTCAGACTTCCCATGAAACTCTGAACTCCCTTGAGCGTTGACGGGAACGGCAGGTCTTCGA
CACCTTTAGCGATCTTCGGCGTAGCTCTCAGTCCCTCGGCACTTATCTCGTGAGAGAGGTACGGGATCGAGAGTTTCCCAAACTCACTCTTCGGCAAACT
CACCGAAATGTTCCAGTATCGAAGtcggaagagcagcgcaTTCAGGTCTTCACAGAGTTGGTCCCAGGTGGGAGCGCCATGAGCAATGTCGTCGATGTAC
GAACTCCTACCCAAAACTGGCCCCATGCATACCGGCACAGGGATGTTCCTCTGGAAAACAGTCATTTGGCTCGTGAGTGACGACAGAGCTGCTTCCGGTT
TCGGACTGGCAGAATTCCGAATTCGATTTTCAGAGCCCTGAGGTTCCAATTCCAGAAACTCCAGAACTTCCGCATctacttcagcttcttcctcaggCGG
TAGTCTCACAAAACCCCACAGGCAGTTATCCAGCATAGCTTGATATACCAGTGGTGCGTTCTTCAACCCGAAAGGCATACGGACCCACTGAAAATGGCCG
AATGGACAGACGAACGCAGAAATCAACCGTGCACGTTCTGTCATCCGGATTACCCAGAAACCACTTGCCATATCGAGGCTCATAAACCACATAGCGGACT
CAAAGCCAATCAGAAGGTCATCAATCAGCGGCAACGGATAATGCGATAGCTGAATGAAGCCATTCACCACCCGATAATCGATGCACATCCGTATGTCCac
gccattcttcttcaggaCAATCACGATTGGAGATGCCCACGGTGAAGTGGAATACTCGATAAGACCAGTCTCCAGAAGCTTTTTCAGAAGTTCATACACT
TTCACCATAAGGTGAGGAGCCACGGACCTCGCACGCTGGGCAACCGGCTTGGCGTCACCTACATCCAGATCACAGACCACGCCCCTTGCGGGCGCGGGAG
CCGCATTGCCATCTCC