Description :
From Genome Similarity Track
Location :
Scaffold_2607:241- 2289
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2607-snap-gene-0.0Gene of unknown function

Sequence
2048 bases(100 bases per row)
GCCAGGAAACACAAAGCGTGCCAGAGCCACGGCTGTGAAGGTATATGACACATTCCTAAAGTTAGAAAATGTTGAGTGAGAGTATGTGAAAAGCTGCATA
TTGAGTGACACGTCTGGGAAGGTGTTTGTGTCTGTGATGGATAAGTTTGGTGTACTTAGCATTTCATGAAGGGAAGGCAGGCAAGTAACTTGCAAGACAA
CATGCATGCAGTACTACCGTCAGGCTAAGCACTGGGCGCTTGATCAATTCCCACAACACCGCCTGGCTCTCGAGTCTAAGCTACTCAAAATGGGCCGAAC
CCTAGAGAGCTTTTGCTTAAAGAAAGAAGGCGGCGGCTTTGCGAAGAAAGCTGTTGGATGTACAAAGGCAGATTTGAGACGAATGATGCACTATTTGTAT
TTTAATGCCTTTACATCAAGGGATTATCAGGATGCTGCATTGCTCAGTCTGCTTTGGTATATGTTTGGGCGCGCGTCTGACTTGACGCATGTTTGCAAGC
AAAATGTCTCGGTCGACGCTAGCGACGTCTTTTTCGCCCGCTTCATACGAATGAAGACGTACGGTGAGCAAGGTCTCTCGCTGTTCGCCGATGCTGACTT
TGCCACATGCCCGCTGCTCACAATCGCGCTGGCTCTCGCAACGCAGACGGCACCGTGCGCCGACCTCCTCAGCAACCTCCATGTACAAGCTTAGCCCGTC
GCACGCGCGCTCGGCTCCGAGACGCCGCTGCTCGAGCTCCTCGACAACCCCGACTCCACGCCCGATCTCCTGCCCTCTAGTGCCACCACCTCCTCTGCGC
TCACAACACACAGCCATGTTAATCGTCTGCTCGACTGCGTCGCCGAGCGTGAGGACGTCGAGCAGCAGCTTACCTCTCACTCGTTTCGACGAGGTGGGCT
CAGGATGCGAACGGCTCAACGGAGCTGACCGATCGCTGGATCTTTGATCGCGGTGCTTGAAACGTGAGCACCACGAACAAAGCCTTCAACTACGTGTTCA
ACACACGTGCCGAGGATCACAAGGTCACCAAAGTCCTCAGCGGGTGGAGCACGTCGAAGCGCGTCCTGCTCGCCGACTTGGCGCCGATCGACGCGCAGAC
GCAAGAACTACTCACAGCCGTCCAGGAGCGGCTCTTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCT
GCGGATAGAGACAATCGCACTCGACAGCCAGCGCTCTCTCACAGACTTGCTCGCATGGTCATCGCATCTTGCTGCTGCTGGCGACACCTGCACAATAGAC
AAAGACACAAAACAAGCCACAACGCCACACGGAAAGGCGAAGAAGCAGCAAATTATTCGACATCAAGCTACTGTTATTGACCATTTAATCGGTCTCGCGA
AGCGGCAAGACCAGCGCTTAGACGCGCTCGAGACAAACGCTAGAGAAGCTGCTCAGCCTGCAAGGCAGAACAAGCGTACAGCAGATGACGATGAGACCAA
GAGAGCAAGAAACGGAGCCAACAATAAGCACAGGAAGCGCGCATCTACCGCTCACCTGCGAGTCGCTTGGTACGAGCGATACGCTGGAGAACCACGTCTG
TGGACCATCATCAGCGAGAAGCAGCGAAAGTCTGACGGAAAGATGCTTGTCGCTTTCTTGAAGCTTTTTCTCGAGGAGGGGTTCTCACTAAACGACCAGC
TTCCGTCGTACCACGACAACGTCATGATTGTCGGAGTCGACGCGGAAGAAATGGCTATCTCGTTTCTTAAGGACCGTGGAATTGCGTCGCGCGGTGTGAC
GTCAGTACTGAAGAAGCTGTGCGTTCTCCATCGCGACGGAGCACTGAACATGCTCATCGCGAGGCACAAGAGACTGCTGTCTGCAGGGAAAATCAGCGGC
CCTGCTCCCCGTCATACTCAAGACATACGCGAGCCTGTAGAACAGATG