Description :
From Genome Similarity Track
Location :
Scaffold_205:2409- 6157
Transcript NameFunction/comments
Phyta_totarag5555hypothetical protein PHYSODRAFT_551377
Phyta_totarag5556hypothetical protein PHYSODRAFT_532795
Phyta_totarag5557hypothetical protein PHYSODRAFT_362533

Sequence
3748 bases(100 bases per row)
GAGGAGATGGCGATGACGCAAGACGATGAACACCCTCCGCACCCGCATCCTCATCCTCAtggcagctgcttcttctgctcacGCGTAGCAATGGTGATCC
ACCACGTCAACCACACGTCTCCGGAAAAGTTGCCGATTGTGAAGACCATTTTGTCGAACGTGTGCCAATTGGTGCCTTCAAAATGCAAGTGCGATGTTGT
GGACAAGAACTTCGACAAGATTGTTGAATTGGAGAAAGAAGGCAAGCACCCTCACGAGATCTGCAAGTCCCTGGGGGTTTGCAACAAGACAGAAGATTGG
GAGAAAAGTGCGCCTTCAATCGCCTATGAAATGAAGGGCGTGGTTGTGGCTTCGCAGTGGCCTCCTGGAAATGCGACTCAGTGCACGTACTGCCAATTTG
CCACCACCGTGGCGAAAATCGCACTTCAGCAATACGGCGCTGACATCCGCCAAGTCCGCGCGTACGCCGATATGATCTGTGATATGCTGGGCGAGGACAA
TCCGTGCCACGTTTACGTGAAAGAGTTTGACTTTGTGGTTGATTCGATCACCAAGGGCATGAGCTCCAAGGCAATTTGCACGGTGTTGAAGTTTTGCATC
ACGATGGTCGCTGACGGTGAAGAGAATGCCGTGGCGTTGAGCTCAGAAGAGCACCCATCCTCGATCAACGATTTGACAGCGTACGACCCGGTCCTGGTGC
AAATAGTGAAGGATTCGATGGCAGTGTCCATTGACGGGTGTTTCTTCTGCACGCAAGTGGCATCTGTCATCGAGGTAGCCGTAGCTGAAGACCCCAGCAA
GATTACGCAGATTCGACAAATCGCAGACGTCGTTTGCGGAATGCTCCCGAGTGACAACCAGGTACGGTGGTTAGCCGAACTCGTACTTCAAGCTGTAACT
GCGCTGAAATTGTCTCTGTATGTATGTTTTTGCAGTGTCACTCGTTTGTGAAGCAGTTCGACACTGTGGTTAATTCTCTACAGAAAGGGGAGCAGCCTAA
GGCTATTTGCCACGATCTGCAGTACTGTACGGTGAACTCCAACCCTGCTATGGCCAAGCTTGCGGTGCCCGACATGATCGCTGTTCAGAACAGCGACAAG
GGAAGCAGCACATGCGCCTATTGCAGTGGTGTTGTCACTGTGCTAAAATATGCACTGGACCAAAAGCCGGGGCAAGTCAAGGAAAtgcgtgaagctgctg
gcattgtgtgccaacttcttcctgctgacGATACGGTACGTAATGTGGTCCTCCAAACTTCAATGGGGTAAACCTAACGAAAATTATGTTGTTTGTGTAC
ATGATAGTGCCACAATGATCTCAAGATGTTTGATGAAGCAGTAACCGATCTGCAAGCTGGAAAGGAACCTCAAGAGATTTGCCAGGCACTAAAGTTCTGC
ACAGCCACTGAAGCTCCCAGCGAACTGATGTCAGGTCTGCTCGACTTCACCGGCTCGGATTTCCTGCCGTCGAGGTGCACGACTTGCCAGCAAAatacgc
tgctgctcgcatCTTTGATTACGCGCCCGGAGAGCTTAGCCACGTTCGAGCGTGAAATCAATTCGGTGTGCCGTTTGATCCCGGAGTCCAGCGAGGTAAG
CATATCGGGCTGTATTCACCCACTGGAGTTATGATGTAGCTAAGAACTTTTCTCTTATGTAAATAGTGCGAACTGCTGATGAAGCACCAAGACGCGATCA
TTGATtcgctgaagaagaatgaAGATGGGGATACTATCTGCACACGAATTGCAGAGTGTGGCCCTGCAGCGGAGGAGGTACCGAAGGATAAGTCGATGTC
CGTCGGCTGTTTGTTCTGCGAGTACACTGCCGACCTCTTGGAGCATGCCAAGGACAATGAGAAGGCCTTGCGCGAGGCAAAGATGACGCTCGAGACGATG
TGCACTGTCTTGCCACCACGTGCACGCTGCGACGTCCTTTCGTCGAAGTTCGATGCGTTGGTGTCGCTCATGCGCGAGGGAAAGAGTCCCAGCGAAGCCT
GTCACGCCATTGCCCTGTGCGACGCGGACTTCGTCTTCTCGCCAACGTCAGGCAGTGGTGAGGACCTCATCGTGCAAGCTTTCGAGAAAGCGCGGCAGAG
CATGGGCAACGTGATGGAGATCCAGTAACCGGAGCAGCTCTCCGTCCTCGGCGCGAATGGGGCGCGCTTTCTTTGTAGGTTGACGCCTACTCGTTGACAT
CGTTCTGCTCAATTTTCTTTTCTACCCCACTGTTAACAACTACAAAGGAGTAATGCCTTCAATGAATAACATTTCAAGCAAGGAAACTACGACTAATctc
gtccaggaactcgTCCGTTGGTGTCCACACGAAGTTTGGCAGTAGGTGAGCGAGGCGTTCAGTGCAAAGTTTCGTGTCGAGCGGTGAAGGGTACCCCAAG
TCCACTTGCGCCCGCAAACTCGGCATGATCTTTCTGGTGACCACACTCCGAGCTGTTGTTTCTtgtgcaagcagcaagataCTTGTGTGCGAGTTCCACG
CGTGAGTGCCCCCACACCACCTACACGAACGGTGAAGAGCCAAAATTAAAAGTAATCAAGATCACTCAAGTTGGCAGCATACCGACGTTAACAAGAGTAG
CGCGCGCCTTGGTGTCGAtcgccagcaacttgaacatGACAGTGACCAAGTCCTGGATGTAGAGATACGAGCGGAACTCGTCActccacagcttcagcgg
TGTGTCAGCAGTCTCGGACTGGAATAATTGGTGATGAAGCCATTGCATGAACTTCGGCGCACTCCTGTCCGGGAATAACGGAGCTGACGGACCGACAACG
TTCGCAATGCGAAGAATCAGCACTTGCAAGATTGCCTCAAGCAGGACCTGGTCAAAGCGCAGTTTGCATGCACCATACACCGACAACTCCGACGACAACC
CTGCCGAGTCTTCATCGTAGTTCTCACCCCGCAACTGAGTCCCTTCATAGACGAAATCCGTTGACAAGTGCACGAATCGAATTGGCCACGGCAGTTTCTC
CAGCAAAGCCACCGAATCTCGAGGCTAATGATCAAAATGTACACAATAATGGCAATAATACAACATCAGAAGCAAAAAAAACTATCACAATTATTTCTGT
CCGCGATACCTCATTGACGGCGCGTGCCTTCTCCAGGTCCCTGCAGGAGACGAAATCGCTGCGTAGCACAAAAAACAATTTTGGTAATTTGTATCATATC
ATAATGCGGGCCATAATTTACCTGCACAATTAATGATCACCGTCGGGTGGAAGTTCTTGATGCAATTCTCTAGAGCTTCCACATCCTGCACGTCCACTTG
CCAGTACACACGCACAGAGCGCGTTGACTGTGCGGCTGCCGTCACAAACCCTGCAGGGAGGGGACAGAGTGGTTGGGTGCGAATAGTGCACGCCACAGCA
GAAATCTCTTCCACTGCATCTCCAGTCGCCACTCGAAGCTTCTCGTCctgttgcagacgctgcagcacgaactGCGCAACGTAGCTCGTCCcgcccagca
cgagcacgcgTGCCATGCTGCGCAAATCTGATTTTGAGCAAGCACAAAATTTGAGTCGAGATCAAAAATCGTGTTGACATCACTCAAAAGTCGGATAAAA
TCCAAACGAAGATGGCGGACGTGGGTttcgtggagatggcgcaCCAAGTGGGCGGCCACGCCACGGCCAAGACAAGTAATGAGCATTGCAATAGCTGTGT
TTGATGTATGTTTCCTTGTCATTCTAATACATTCATTTGTCACTGTAT