Description :
From Genome Similarity Track
Location :
Scaffold_64:24089- 29416
Transcript NameFunction/comments
Hyaar_Emoy2807443carbohydrate-binding protein, putative
Hyaar_Emoy2807444putative expansin-like protein 1 protein

Sequence
5327 bases(100 bases per row)
CACGGGGCAGTCGACAAACTTCCACGCGACTTTGTACCGTGACGGGGTCGTCCCCGTCAGAGCGGTGAACACCGACGGCGACAGGTCAAGGGCGCCGTGC
TTACACTCTGGACAGTGGTCGAGGAGTTGCACGAGAATGGTCTTGGACTTGTCAGGGCACCGATCGTCGCTGCACGAGACCTCGGCACAGCGACCGCAGT
TCTGCAGCCCGTCCCATTGCTCGCTATTCAATGCGGCGTAGTCCGTCACGGCGAGGTTGAGTACCGACATCATGTTGCAGTTACCGGCACTTGACTTGCC
CAGTGTGTAGGCGGTGCCATCGCCGGTAAAGTACTCGAAGGCATTGGCTACTGCAAGGGCGACTACTGAGACGAAAGCGAGCAAGTTGCAGACGTTCATG
GTACCAGATATCAAGATCGATTGAGGACAAGGTGTGCAAAGGTGGATGCGTGGGTGTCAACTGACTCGACCGATGGCAAAAGCAAAAGTGAGGTATCAAA
TGGCAAGGACGAGGCTAACAAAGCACCACCGGTTTCTTTGGCTCGAGATTGAGCTGTCGACAGTGAGGCTAGAGAGATCTCGGTCTTACTGCACCTCGCG
GTGACTGGACAGACCTCCTCATCCAGCTGGGAGGATGCACTAATAGGAATTGCGCCCAAACGACAGCGTTGTTTGTATACGGAAAAAGCGCGAGCTTGCA
ACGTTTTTTTTCGAATGCGACATTGAGATCAGTCTCTATTGAGCTGAATGGTCGGGATGCCTTCTGTCGCGATGTCAGTCATTGTCTATGGACCGGTTCG
TGCGAACTCATAACTCATATCGTGCCTGTGCCGAAGCTCGAGGAAGACAGGGAGGAGCCATGTGACGCACGAGAAAATGCGAGCCGCAGTGTCGTGCGTT
GCTGACTCTCGCTTTAAGCACGACGAATCACTCCACTTGTGATCAATTCTGAACTCAAAAGTGAAGACAGTGTGACGTTTTGTCGACTGTGCCGCACGAG
ATAAAGGGCTCATTTTGGAAGGACGGGATTTTCGAACAGACAAACGGTACGAGAGACACTTGCGTGGACAGCTACGGGGTCCGGCTATCTGAGCGACCGA
GTCACGTCATCTGCTGGCGAGCGCCGCGCACGTTGACAGAAAAGATCGCAATCCAACGCTTTGCCGATGTTCGGCCGGGGTTTTTACGGAACACCATCAC
TATATTCCGACTATAGCGACATAAAGGTTACTGTTCAACTTTTGACTCTACTTAGTAGATGGATCCTCCCGCAGGTACGGACTGCCATGCGAAAGCCCTA
CAGAAAGAAACTTACACCTATTGGACATCTTCAGCTTGCTACACGGGGCAAATGACGGGTCCGGAGCTACTGGGAGCTGCAATAGTGTCGCTATCCGCAG
TCTGCCGAACCACGTCGTCCTCATACCTGGCGATTGTAGGACTCTGCTTAGCAACATTCGTCCTTCTGTCGCTAGACGTTAAGTCTGAAGTCGTCACTGT
CGAGGTAGTAGAGACGCCGTCTTCCTTCACAACTTGCACATGACTTGGCTGTGACGTCAACTTCACCTCAAAGTTGATGCTCATGTTGTCCTTCCCTTCT
GAGCTTGACCCCTGCCGGGTGCTCTGAATACTTCCGTAGCTCGGTTGGTGCCATTCAGATGGAGAGACTGCAGGAGATCGTGTAGCTGAAGCATCCGGTG
CTTCCGCCAACTCCTCACCATCGACGCTTGGTACTCCGGACTGTTGCAGACGAGTTTGACCGTCACCTCCTTTCGTCGGTAAACTAGTAGTATATGATGC
TTCAGTCTCCTTTGACACCTCGTCCGAGCTAGGTCTTTGCTCGATACTATGATCCGAAACGTCAGTCGTCTCCGCGTATACATTCTGCTCCTCATGCCGC
ACTGTTGTAACGCTGGGGTCCTGTCGAATAGATCGGCTTCCTTCTGCAGCGGTGTCCGAGCCTTGGTAAGTTGCACCGCTGTTATCGGATACCAAGTCAG
GCTCAGCGGTCGGAGTGGTATCGTTGGCGCTTGCCGAATGCGGAGGAACATGGACTGCTTCCGAAGCATTGAAGACCACAGCACTCTTTTGCTGGTCTTG
AGTCGGTGCTGTGGTAGTAACAATTGCAGTCGGTGTAATCACTGTTGGAATCGTCGGTGGCGGCGCCTTTCGAGTCACTGTAGTCGGTACACGGATCGGG
GTAGACATAGTTGATGGTAAGTTGGTTCGAGGCTTTGACGGACGCCCGCTTCCGGACGGTGGAAACTGGTTGGTGCCCGTCGTGCACGAACCAGCAGTTA
GAGACACCGTGTCCATCATGGAGACACCATTCAGGTCCGTCATTGACACGGCAACCTTGGAAAGGTCTGCGACGGTCGTACCTGACCCATCGAGAAGGTA
ATAGTAGGCTCCATCCAGCATCTTTGTGGCCTTGCCATTGATCGTGAGACTTGTGATACCTGTGGCAACATTCGTCGGCTGAATGGCCGTCCAATAATTG
TTGCTGCCACCCTTAAGGCAGTAGTTCACGTTTCCAGCTACAGGGCAGTCCACAAACTTCCACTTGAGAGTATATCGCGCCGGGTGGGATCCTGTAAGTG
TCTTGAAGACTGACGGGGACAGGTCGAGGTCGCCGTGTTTGCATTCCGGACACCGATCAAGGATCTGGACCACAACAGACTTTAACTTGTCAGCACAGCG
GGAGTCGGCACATGTCACTTCAGCACAGCGACCGCAGTTCTGCAGCCCATTCCACTGGTCGTTGTTCAGCGCAGCATAGTCCGTGGTAGCAAAGTCGAGG
GCCGACATCATGTTGCAGTTACCAGAGCTAGTGTCTCCGAGGTTGTACGCAGTACCATCTCCCGTGAAGTACGTATCAGCAGTGGAAATGCCCAACATGG
CTGCAGTGGTGACGGAAATGATGGACATCGGTGACTTCATTGTTGAAGGGGACAACCGTACCGAGTGGTCGAGATGTGGAAAATGGAAGAGTGCCGTCAA
CGAAAACAGGCATGAAAGACGAGTTCACGTAAGTTGAGCTGCTTCTTTGCTCTGTAGCAATGAGGGGGACAGCAGTGCTTTATTACCTTCTGGGCATCAC
GAACCGTCACGTTGCGTTGCGATAGCTAACCCCATCATTATCCAGGTAGCAGCCGTTTACAACAACTGTTACTGTGGCTTACGATGAATGGACTTGGTGA
CCACGTGACTTTCGTGGATTCGCAAACTCTTCCTAGTCGACAGGAGGTTATGCAACATACAAATACGTGCACTTATTGCGTAACGAACATCTGCATGATC
ATGTGGTAGCTGTCGTGTTTTTGGCCCTCGGAAAGAGTTTACAACGATAAAGCGTGAGGGAGAGGCTAGAAGTGTGTAGTTGTCAACCGGCTGGTGTAGT
TTGGTCAAACTCTCACGTGCCCTCATATGTGTTTACAGTGTAGGTATGTGCGATTGTGTAATGCAGCTGTTGTTTGCAGTCGAGTGGATGCAACGGCCGC
GATTTTACCTCGTGCTGGAAAAGCAGCAGCTGAGCAACAGCATGTTATTCATCCAACAGCAGTACTGGAGAAGGAATGGAACGACGCGTTGGAGCTACGA
GCGTATGCTATCGAACTCTTGGCTTGAAACGGTTTATCTCAACCGCTTCGCAAAAAGAACCTGCCAATGGAGATTGCATCGCGCGCTATTCGTGACTATT
ACTTGACGATACGCACCAACGTGGGAGAACTGCTGGTACTTGAGTCGTTCCAATGCGAACAAGATGTGCATGATAACACGTGCAGTGGTAAATGCTAAAA
GTACGATTGTAGGCGAGTGGTTGGAGCTTGATGTTTTTGTGGCAGCGAATTTATAGCTCGATAGTGTTTGCTGCACTGTGTACGCCTTTCATTCAGTGCA
TGGTGGTGATGCTATTATTGCGAGCCCGAAGGGTGAAGCTATTAGTGACTGTGCGCAAGGTTGAATGCACACAAAATCGTACTTATCTGTGTATCTTTCT
GTGTGTCTGTAAAAAAAAATAACGCAAATAACGCGGTTAGGTGTACCTTACACGCTCTAAGTGCGATCTAGGATCTAGTCCACCTCATAGGTATAGGTAT
ACCTGAAGTCACTCTTTGGCTAGGTCACTATTTTGGAGCATGAACGTGATTGGCTTAAATTGATCAAAGGTGAATATGATCGAATAAGCAAATGCTGGAC
GCTTATAACCGATCGCGTTGCCCAAGTATACTGTACTGGCTTAATACATACATGTGCAGCATCATACACATTCTTCAGTGACTGCTGCTGTTGTATAGTG
TTTTGCAACTTAATCCAATTCTATGAACTGAATTACTTATATCAAAGGCCGAGCTCCAGAGCTTGCTCCCCTATCTTATTTATTATGATCTGCTTATGAG
CAAAGCTGTCGTAACTATCGGTTACGTAGGGGATATACAATACCGGTATTGATCATACTACCTGTCCTTTAGCCTTTTATGACAGATCCGTGACACCCGC
CGACACTTATATACTACTACTGCCTACGCCACGTCAATGGAGAACATACTCAAACACATCTTACATTTGAATAGCGTCAACCACAGATCGATAAATGTGA
TGTCCTACCTGATACGTATCGAGGACTTACGTCCAGAGTAAATTCGTGGGGAGACTGATTCAGTATAAGAACAATGAACAAAGAAGGAACCTAAATCAAT
CGCGGTGCTGACATGGGTGCTCAAACAAGTATATTTATCTGGTGGTACGGCTATGAGCGATGTGTAGCGTGTGCAAAAAGTCTCGACGATATTATGGTAT
TCAATAATGCCGCTATAAGCCCATTTTCAACGTTCTGGAACTGGATCTTACCTTACGAATACGTAAGCGTGTAGGGGTTCGGTACGTTGGTTTGTTTCAC
AAAATACTAGAGAAGGGTAGAAGTCTAAGTGAAGTCGAGATTGACGTAATGCACAGACGTGCTGGAACGAGTGAAGTCTATCGTGTAAGCTTTTTGTATC
CCCAGACTCTCGGTACATATTACGGGTTGGGGGCCACGGAATACCATAAATTATACTCTTGAAGTATTTATAGTATCAGCACCCTTGACGGAATAACATC
GGAATGATGGAAAAAGTTAGAGCAAATGTTCCGGAAAGGTTCATAGATATCATGAACCGGTATGAAGCAGATTGATGAGGTTGATGCTGTGATAACAAAA
GAGACTTAGCAAAACAACTTGGAGAAGTCAGCGAGTTTACCCCTACCTTCGCCGCTGCATCAAAAAAGTGTTGATGCGAAAATAATGACGCTAGTTCTTG
TCAGCACCCGATTGACATCACATAGCC