Description :
From Genome Similarity Track
Location :
Scaffold_12:24089- 25637
Transcript NameFunction/comments
Physo_130576hypothetical protein
Physo_108492catalytic

Sequence
1548 bases(100 bases per row)
TCACCTTCACCGCCAACTGCGTGAAGTCCTGGTTGAACCTGCACTCAGTGGCTTGGAACACGCTCACAGGCGGCAGGAAGCGCTGCATGTGGCGCGGCAT
CGACTTCCCGGGGCCAGCGGACGACGAGGACGACACCGACGCCGAGTGCAGATTGAACACGGGCTCGCGGTACAGCTCCAGCCGGTCGCGCGCGCACATG
TACGTCGGAAACTCTGCTCAGCACCACCACAGCATAGTAAAATCAAATCAGTTTTCTCTGCTACAGCCAGTTATCGCGCTGAATCACCGCGTACCGGGCA
GTCTGCGCATGTATCGGAACTGCGCCGGGTGCGCCGCGACCGCCGAGGGCTGCTGACGCGGCGGGAGGTCGCTGCCGTCCACCGGTGCGGATCCAGTGGG
GAACTCGAGCTGCGCGCGGATGTAGCCATTGTTCTTGGCGTTGGAGAAGTAGCCGCGGCGGATCTTGAGCCACACCTGGTCCTCGTAGTACAGCACGGCC
GAGCACGCGAAGTACGAGCCCACGCGCAGCTCCCCGCAGCGGTCCAGCAGGCGCTCGCGCGGCGTCGAGTACACGAACAGGCGCTCGCGGGTCAGCAGCG
CCGAGGAGGACGCCGCGCCGCCGTCCCGGCCGATGTACTGGAAGAACTCCTCCATGCTGATGGCGCCACGATTGACGCACTTTGACTACTGGAGAAAGAA
AGGCAGAGTCGGGCGCACAAATGGAAGAGGATGGCAATTTCGGCCTATCATGTTTGAGGAAGAGTTGTCAGATCTGAGTTGAGTCGAATTTTGAGCCAAT
TAGAAAGTGGTAGAGTAGCCTATCAAATTGGACGATTTACACACGTGGTTTTTCTACCAATCGGATCGTTTTATCTTACATGTTGAAGCGGTCTCGTTGC
TGCTTCTTGGTAGCAATGCACTTGTGTGTCTTCATCGAAGGCAAGACGAGTGTGGTTTGTACAAATATACCATGCTTCGTGCATTGTCAAGTGAGGTGCT
GCTCTGATGCGATTGTCGGCAGCTTGGGAGGACGCTTACTGGCCCTCGCAGAAGGTCTTGGCGTTCTGGAAGATCTGCATCCAGGGGCTCACGGGGTGCG
CCTCGAACTCCGCGGGCATGTACGGCCACTGGTACTTGAGGAAGCAGCGCTCCGGGTGCGGCATGAGGCACATGTGGCGGCCGTCGCTGGACACGAGGCC
GGCGATACCCTCGGGCGAGCCGTTCGGGTTGAATGGGTACTCCGTCGTCGGCACGTTCGAGTCGTCCACGTAGCGGATGGCCGCCGCGCCGCTCGACACG
TACTTCTCCTGGATCTTGGGGTGCGTGAAGTGCGCGCGGCCCTCACCGTGCGAGACCCACACGCCCAGGGACGAGCCGGCCATGCCGCGCAGCATGATCG
AGTTCGACTCCTGGATCTGCACCGACACGAAACGGGACTCGTGGCGGCCCGACTCGTTGTGCACGAAACGCGGCTGCGCCGACGTCTTGGTCTCCTCCTC
GATGGCCTTGGCCTCCGGGTGGTCTAGCCATCCGAGCAGCGTCATGAA