Description :
From Genome Similarity Track
Location :
scaffold_324:24087- 25191
Transcript NameFunction/comments
g7268.t1 Major Facilitator Superfamily (MFS)

Sequence
1104 bases(100 bases per row)
CCACGCAAGACTCTCGCAACCTTCCTGTCCTCGCGCGGGGTGTTGAAGACGTAGGCGAAGCCTTTATTCGTCTTCGACATATCCCACGAGCCCCGGTCGA
AGATCCACTGCGCCGCCAACCGCTCGTCGCCGTTCGCATGCTGGGCGCCGCCTCTGCGAAACGAGTGCGAGGTGAGACTGCTGCTCACTCCAGATGCTTC
CGCCACGCGCCTCAACAGCCTGTTGACGTAGGCTTGGACGCCATCTTCTCCTCGGGGATGGCTTCGTGGTGCAGGTGAGGGAGTCGTCGCGCGCGTTGGA
GCTTTTGATGGGCTGGTCGGAGACGAAGTCGACTGCAGTAGCTCAAGGAGTGGCACACCAGCGTCGAGATCCACAGAAGCCGGAGGCGATAGCGTGGGTA
GCTGGCTGAGGAGCGATGCGCTGGGAGCCTCCTGCATCACCAAGGCCACAGCAAGCGTGACGATGGGGCAAGTAAGAAAGTCACTTTGATCCGGCACGAG
GGTCAAGCCTTGCTCCTCAGATGTCTTGACCCGTAACATCCTAATATAGAAGACGTTGTCTGCAGAGATAGTGATGTGTTGCTTGTTCATGAAGGCTAGG
TCAGAAGAACGTCCAAAGCCGTGCCACATAAGGCAAGCTAGCGCAGCGTCTTCGTAGTCCATTGCAACCGCAGCTGTGGTGTATAGATGTCGAATCAGCG
CTCGTAGATCCGTCTTCGTGCAAGGTGGTGCCTTGTTAACCAAGCCTCCTTTCTCACGCTTTAGGCAATGCTTTTCGAGTGTCTTGCCCTTCTTTAGAAG
ATCAGCTTCGCTGGGTTGTCTAAGATGAGGGTGTTCCTCAAACAGCCAAAGTTTCACATTTCTAAAGTAAGAAATTGCAGAGTTGCGAGAAAGCTTACCT
TTCTTTCCTTCATGGGTAGCTAGGTAGTAACCGAAGCGGTCCCTTAGAGCCGCGACGCTTTTGCTTGGATTGTCGCCGAGAATGCACGCCTGGACAACGT
CCATGCTTACATTCTCGGCTTCAAGCATTCGCTTGAAAGCACATATTGTAGTGCTGCGTGCCTTCTGCGTGTTGGGCGGGATAAACGCGGCAAGGCTCAT
GTTG