Description :
From Genome Similarity Track
Location :
Scaffold_19:240854- 243826
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007652Protein of unknown function
Pytul_DAOMBR144PYU1_G007651Similar to SPAC1D4.10: Probable ribonuclease Z 1 (Schizosaccharomyces pombe)

Sequence
2972 bases(100 bases per row)
GCCGCCCGTGAGCACGAACTTGTAAATGGGCGCGATGTCGCTTTGGCCGCTCTGCAGCGCGCTGAGCAGCGGCGGTGGCGACTCCAGCTTCGAGACGCGG
CAGTCCTGGGACCACATCTTCTCGTTCTGGCCCATGGCGGCGGGGGGCGTGGGCTGGGCGCTGGTACTGGCGGCAGCGCCGTGGGCAGGTGGCGTGTTGG
GGGCAGTCGGTGCGGGTTGCGGCTGCGGAACGGCACTGGCGGCGGGGGGAGAGGACGCGCGCATCTACAGGACGACGACCGGCGCCATCCGCGCGTTAAT
GGAGGGATGGGCTTTTTCTTGGGTGGCAGGGCATTCGCATTCAGCGGGATGTCCTAGATTAGGGGTGGGGAAATGCACGTTAAAGTAGGCTTTGGCCTGG
TTTCAACTGGCAAATCACTGGCGGAGACACTGCTTCAAGTGGACGTGTCCTGAATGAGCGGCAACAGTAGGCCTCATACGGAAGTGAGGCGGTTTGAACC
TTTCTATGGAGGGTTTTACCTGTTTAATGATGATTTTCGCAACGATTTGCTGGTAACATAACAGATGGTGGGGAAAGCATTGAAGTATGTGATATGCGAG
GTGCATTAGCCCAATGTTGCATACGGTAATTTACGGTACGTATATTTCAGTCCAGTCAGCCAGCAGAAGAACCACAAAAGAGTGTGCTCTTTTAGGAAGT
ATTTCTATATAAGGATTTTTGGGCAAAAACATACTTTTAGATTGAAACAGTGATGCAGGAATATTGGTACCTTTATATGCAAGTGTAGGTTTCATTGGTA
CCTTTTATTGAAATTAAAATGAACCTACGTTTTTCAGTCTTCTCGTGCGTGTGTGTGGAACTGATCTGCTACTGGCTTTGTTCACAAAGAAACACAACTG
CAACAACCTCCAAGATGCGATTCTTTGTGGAAAGCGCCTTGGAAACGCACGCCGACGATCTCGAAGCATCTACGAGCCCAAGATTCGCAATGGCACAATG
ATGCAGACACACAGACAGACTGGACTAGGCAAGGCCAGACACTGCAGCTGATCCTGCAGTCTGCGTAGATAGCAGGTCCTTAGGTTGCTGTTCCTCTACC
GTTATGATTTGAAGTAAAGGTAAAATTCTCCCCAAATGTCAGCAGGCAGAGATTTGATAAAAAAGTTTTAAATGCGAACGAAGTAACTGCAAGGCTGTTC
TGGGCTATGCTGCTTTGTCTGTTAGCCGCTCTATGATCTCGCTGCTGTGCGTGTCCCACAGACAGAAGAACCACCCAGTATCTAAAACTGCTTGTGCACA
TGTCGAAACCAAGATCGCTTTGCTTTTCTTTCGGCAAGCACGCTTTACAAAAAATTGTATCCATTCACTTTGAGTAGGAAAATGGTTCCATCACAAAAGT
AGGTAGGTTCGTTAGCGACAGTATGTATCAAGCTACCGTGTTTTGGCACAGCAACCCCAAATCGTACTTTGTCGAGGTGATACATTTTTCGTACCCATTT
GTTGGCCAACTTGATCAGATCGCGATGCGATGAACATAGCCATCGTACGCACATTGCACATGGGCCGCCAATAGTGTTGATTCGTCAACAAATCTGTTGT
CGCCATTGGCATCATCAGTGTTGGAAGACAGCGAAGCGATCGGCGGCGGCAATTTCGGATATCGCTGGCTGAAATGCGTCAAGATCACCTCAGTGGCACG
CATTTGACGCGCGATCGTCAGAGCTTCGCCGACTGTGCTGTGCTTCTTCTTCACCGCATCTTCCTCCATCGAGTCATCAAACGTAGCTTCGTGGATCAGC
AGACTCGCATCCATTCCTACAAAAGAATGTTAAGCATTCACAGTGAGCGGCACAGTTTACACCCATTTACGAATGCAAGCGTACCTGCTGTAACCAACTG
GTTGCAAGGTCTCGTATCTCCTGAATACACAATCTTTTGGCCATTTTGCAACTGGAGCACCAGTCCGTACGAGTCGTAGCAGTGCCAAACAGGGACACTA
CGGATCTCCCTGACCACGGCCCCAATGTGTGAGAACAACTGCGCGCGGAACGGATGGTGATACTGATTGAAGTCTCGACACGTCGCAAACCCAAAGAAGC
TGGCGCGACGACTTGACTCGACACCACACGCACTCATAATATGCTCGACCCAGCTGTTCGCGTAGGAAAGAACCGACTCGGGTCCGATGATGAGAAGCCC
CTGTCTTTGGTTCAAGCCTCGCGAAGTATGGAAGCAAACGTACTCGTACAGAATGCGAACGAGTCCGCATTGATGGTCTGCGTGACTGTGCGAAATCCAA
ATGCAGCGCAAGCCACCGATACGTGCAGCTGTAGCGTCACCGAATTGGCGCCAGAGTTGACCATAGGTGCCTTCTCCACAATCGATTAGCATCGAGTCTG
TCGGCATGTCACCATGGTCGCTTGGGACCGCGACAGGAGCAGCTTTGCTTTTGAGCTCCAAGTAGATGCCAGTGCTCCCGCGCAACCTGGATGGTGCCGC
ACTGCCTGTTCCCAAAATGATCAGCTTCATTGTGCCGCCTTGAGGAGCTGCCGCTATTTCTCTAGAAGTACCAGTCACCTGATCATCAGATCCGAGTTGT
GGCTCTTCGTCTGGGTCACTGGAAGCTTTCTGCTCCGTTTCTTCATCGTTCGGGCCGCGCGGCTGCCATCCAGTTCGCTCGTAGTCGAAATGCGGTCTTC
CTTCGGAAGACCTATGGCTGCAAACCTGGAACCGCAGTTTGCTTTGCGCAATATGCGCGTCGTTCTCATCAGCAGTACTCAGTTTCATGAGAATCTGCCG
CTGACTTGCTTTACTGGACGAAGACGTTTCCTGATCGGCCAAGAATGTAGCGAGGTTTTTCCACATGGAATCCGCATCAGAAGACCCGTTCCAGTGCTGG
TTCTGCCCCAATGTATGTTTCGCCGATGCATGGAAGACCCAACTGTAGACGCCACTTTCAGCCGAACGAAGT