Description :
From Genome Similarity Track
Location :
Scaffold_1127:2408- 3557
Transcript NameFunction/comments
Phyta_totarag12138Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family

Sequence
1149 bases(100 bases per row)
GTGTACAATCGtacgcttcttccagtccatCTTTGGGTCATATGTGCAAACCACggcatgcccagcaccaagtcgaacttgtcgtctaCATCCAAGACGA
TAAGTTCTTCAATAAACTTCTTTTGTTGGCACGAGACGTGTACGCGTACGACACACTTCTCGGATTTCACGACGGCGCCTGTTgccagtcgtacttccaa
tacacttcgaggtgtttgtacctcctcgaagtcaaGGCTTGATAgactttgctgtcgaacaGAGTTGCTCGACGCACCTGAGTCTACCAAGGGACGAAGA
GAATCCGTTCTCTTCGAAGTCACGTCCATGATGCAGTGAGAATGCCTCTCACTGGGGGCTGCAGTCCTCACTTTGACGCGTGTCCAATGTCGGCACGCGT
GACTGCTTCACCAGTAGGGCGCCCCGCGCCTACGGATTCAGCGCGTTTTTTTATTGATCGCGGAGATGTCGTgcatcgccacgttggcCTCTCTGCCCGT
GCAcaggtgctgtgcactcaCACGCAAAATGACCGATGCGTCGAAACGGAAGTATCGTACGTCGGctccacgacgtggtgggtTATTCCCAGCCGTCGCA
TTTCGAGAGGTCCATTGGCTCCGGACCTCTCGCCCTTACCACCGGACGTGGCATCCTTGGCACGTTCACATGCAGCTTAGCCTGCCGCAGGCTAAATTCT
TCTGGCATTGCGAACGTgatcgcagcttcgagcaaACTCGGGAATTCTCGGAAGAGATAGGTCTTGATGGGTCCATCTTTCAAGCccttcatgaacgtga
cgaccTTGGTCGCCTCGTCTATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCATAAGCATGAATATCATGTTTATCTTGCTGCAG
GTCGAGGAACTCTGCCCTCGATCGGAACTCGCTTTGCGGGACCTCAAACGCTTGTCTGAGCTCCTGCTTGAAAACCTCAtacgtgctgaagcacgTAGGG
TCCGCGAGTCGGCGTCCGTATGCCTAACGTCTTGCTCGTCCACCAAGGCACGACATGGTGAACGCAACTTTTGACAACGGTTCGACGATACGTCGAGCCG
TAATAGCTGTGTCGACTTCGACAAACCAACAGAGAAGAGGTTCGCCCTC