Description :
From Genome Similarity Track
Location :
Scaffold_191:24076- 27307
Sequence
3231 bases(100 bases per row)
GCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACCAACGCGGTGCACGCGTCCACGGGGGTTCACG
CCGTTCTACTTGAACGGCTTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCC
CTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATG
CCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGCTATTAGACAC
GAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCG
TACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGA
CCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAAGGCTGCG
GTCAAGACCGTACGCCGGAGGGGCTTCATACGAACGGGACCCCGGCGCCATACGCCGAGTACGCTGAATACGCCGGGTACGCTACGTCTGGGAGTGTGCC
GCAGGCAGCTCCGGACGTGGCAACATAGACTCGATCCGTCGGATCATTCGAAAGGACTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGT
GCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGCGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCATTACC
AAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGG
CTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAG
GAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGAAGGGGTTATGCCCACTCCAAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACT
GCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCG
TACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCATATTACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCAC
GCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCCAGAAACATGTCC
TCACAAGAACTCCAAGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCCAAACAGGATAGAGACCACCCCGGGGTCTCGGGCTTCTTACGACAAGT
CGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGT
TCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAAT
ACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAG
GTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGAGACTCTGATAG
GAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAA
GACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTGGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCAC
AGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCC
GCAGGAGCATCATGAGTGCTCTCGAACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACG
AGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGC
AGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATG
TTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGACCGAGTCGA
TGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGT
AGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCAT
TCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTAC
AATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCT
CTAGCGCAAGGTGCTGTGTGACCCCGTCACA